Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RRP8
CRISPR
in K562
Control:
NT-BGKcLV46-1,NT-BGKcLV46-2
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
RRP8
Cell_Line
K562
Method
CRISPR
Exp_Name
RRP8-BGKcLV46-K562
ENCODE_series_ID
Batch_ID
BGKcLV46
Pool ID
Pool-250312
Local_Set_Name
set77
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1
RRP8-BGKcLV46-83
Rep2
RRP8-BGKcLV46-84
CN1
NT-BGKcLV46-1
CN2
NT-BGKcLV46-2
Rep1_qPCR
45.6
Rep2_qPCR
50.4
Rep1_WB
60.4
Rep2_WB
85.7
Antibody Cat#
A304-201A
Antibody Lot#
lot# 1
Antibody DCC ID
Status
Submitted
Project
ENCORE2
ID
1652
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV46-81
BGKcLV46-81
BGKcLV46-82
BGKcLV46-82
idx
0
0
0
0
TRCN#_or_BGC#
BGC#0001267
BGC#0001267
BGC#0001267
BGC#0001267
shRNA_or_gRNA_sequence
AGGTTCGAACATCCTCAAAG
AGGTTCGAACATCCTCAAAG
AGGTTCGAACATCCTCAAAG
AGGTTCGAACATCCTCAAAG
PAM
CGG
CGG
CGG
CGG
Name
RRP8_87
RRP8_87
RRP8_87
RRP8_87
Sample_ID
BGKcLV46-81
BGKcLV46-81
BGKcLV46-82
BGKcLV46-82
transduction_Date
12/20/24
12/20/24
12/20/24
12/20/24
days
D6
D6
D6
D6
RBP_name
RRP8
RRP8
RRP8
RRP8
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3492
3492
3781
3781
WB_result
61.8
80.3
65.9
80.5725
Ave_WB
WB_DONE_date
1/15/25
5/15/25
MW
51kd
IP
antibody_Cat#
A304-201A
A304-202A
lot# 1
lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
0
0
Rep2_TPM
0
0
0
0
Action
Library_start_date
repeat_library
Note
ID
6087
6089
6088
6090
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV46-81
BGKcLV46-82
Sample_ID
BGKcLV46-81
BGKcLV46-82
Sample Name
Sample Name
RBP
RRP8
RRP8
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-02-10
2025-02-10
Project
ENCORE2
ENCORE2
Note
ID
14118
14119
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back