NXF1      CRISPR in K562      Control: NT-BGKcLV46-1,NT-BGKcLV46-2

General Information
RBPNXF1
Cell_LineK562
MethodCRISPR
Exp_NameNXF1-BGKcLV46-K562
ENCODE_series_ID
Batch_IDBGKcLV46
Pool IDPool-250312
Local_Set_Nameset77
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1NXF1-BGKcLV46-49
Rep2NXF1-BGKcLV46-50
CN1NT-BGKcLV46-1
CN2NT-BGKcLV46-2
Rep1_qPCR
Rep2_qPCR
Rep1_WB68.2
Rep2_WB68.8
Antibody Cat#A303-915A
Antibody Lot#lot# 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1644




Experiment Information (Status: NotSatisfied)
BGKcLV46-51BGKcLV46-52
idx00
TRCN#_or_BGC#BGC#0000197BGC#0000197
shRNA_or_gRNA_sequenceCTTGGGAAATCGTTCGCGAACTTGGGAAATCGTTCGCGAA
PAMTGGTGG
NameNXF1-99FNXF1-99F
Sample_IDBGKcLV46-51BGKcLV46-52
transduction_Date12/20/2412/20/24
daysD6D6
RBP_nameNXF1NXF1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc40523983
WB_result19.5-0.8
Ave_WB
WB_DONE_date1/6/25
MW70kd
IP
antibody_Cat#A303-915Alot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID60576058




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV46-51BGKcLV46-52
Sample_IDBGKcLV46-51BGKcLV46-52
Sample Name
Sample Name
RBPNXF1NXF1
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-02-102025-02-10
ProjectENCORE2ENCORE2
Note
ID1410414105




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database