Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
MARS
CRISPR
in K562
Control:
NT-BGKcLV46-1,NT-BGKcLV46-2
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
MARS
Cell_Line
K562
Method
CRISPR
Exp_Name
MARS-BGKcLV46-K562
ENCODE_series_ID
Batch_ID
BGKcLV46
Pool ID
Pool-250312
Local_Set_Name
set77
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1
MARS-BGKcLV46-45
Rep2
MARS-BGKcLV46-46
CN1
NT-BGKcLV46-1
CN2
NT-BGKcLV46-2
Rep1_qPCR
60.3
Rep2_qPCR
57.4
Rep1_WB
87.7
Rep2_WB
87.5
Antibody Cat#
A303-960A
Antibody Lot#
lot# 1
Antibody DCC ID
Status
Submitted
Project
ENCORE2
ID
1643
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV46-47
BGKcLV46-48
idx
0
0
TRCN#_or_BGC#
BGC#0001031
BGC#0001031
shRNA_or_gRNA_sequence
CCCGGGTTGCTTGCCGGTGC
CCCGGGTTGCTTGCCGGTGC
PAM
TGG
TGG
Name
MARS_82B
MARS_82B
Sample_ID
BGKcLV46-47
BGKcLV46-48
transduction_Date
12/20/24
12/20/24
days
D6
D6
RBP_name
MARS
MARS
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3939
4096
WB_result
78.9
92.2
Ave_WB
WB_DONE_date
1/6/25
MW
IP
antibody_Cat#
A303-960A
lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
6051
6052
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
MARS
Product_ID:
A303-960A
Lot_ID: 1
Source: Bethyl Labs
Target Name: MARS-human
Experiment Status
BGKcLV46-47
BGKcLV46-48
Sample_ID
BGKcLV46-47
BGKcLV46-48
Sample Name
Sample Name
RBP
MARS
MARS
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-02-10
2025-02-10
Project
ENCORE2
ENCORE2
Note
ID
14100
14101
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back