Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
ADD3
CRISPR
in K562
Batch: BGKcLV46
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV46-3
BGKcLV46-4
idx
0
0
TRCN#_or_BGC#
BGC#0000593
BGC#0000593
shRNA_or_gRNA_sequence
CTAGGCTTCTCTCGAATGAG
CTAGGCTTCTCTCGAATGAG
PAM
AGG
AGG
Name
ADD3_90F
ADD3_90F
Sample_ID
BGKcLV46-3
BGKcLV46-4
transduction_Date
12/20/24
12/20/24
days
D6
D6
RBP_name
ADD3
ADD3
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3776
4280
WB_result
0.0
0.0
Ave_WB
WB_DONE_date
12/31/24
MW
79KD
IP
antibody_Cat#
A303-715A
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5999
6000
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV46-3
BGKcLV46-4
Sample_ID
BGKcLV46-3
BGKcLV46-4
Sample Name
Sample Name
RBP
ADD3
ADD3
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-02-10
2025-02-10
Project
ENCORE2
ENCORE2
Note
ID
14070
14071
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back