Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RPS15
CRISPR
in K562
Control:
NT-BGKcLV44-1,NT-BGKcLV44-2
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
RPS15
Cell_Line
K562
Method
CRISPR
Exp_Name
RPS15-BGKcLV44-K562
ENCODE_series_ID
Batch_ID
BGKcLV44
Pool ID
Pool-241015
Local_Set_Name
set75
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1
RPS15-BGKcLV44-57
Rep2
RPS15-BGKcLV44-58
CN1
NT-BGKcLV44-1
CN2
NT-BGKcLV44-2
Rep1_qPCR
53.2
Rep2_qPCR
50.6
Rep1_WB
62.7
Rep2_WB
52.7
Antibody Cat#
A305-041A
Antibody Lot#
lot # 1
Antibody DCC ID
Status
Submitted
Project
ENCORE2
ID
1607
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV44-59
BGKcLV44-60
idx
0
0
TRCN#_or_BGC#
BGC#0000812
BGC#0000812
shRNA_or_gRNA_sequence
CTCCCGCAGCCCGAGATGAT
CTCCCGCAGCCCGAGATGAT
PAM
CGG
CGG
Name
RPS15-92
RPS15-92
Sample_ID
BGKcLV44-59
BGKcLV44-60
transduction_Date
7/30/24
7/30/24
days
D6
D6
RBP_name
RPS15
RPS15
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
4714
5003
WB_result
Ave_WB
WB_DONE_date
8/19/24
MW
17KD
IP
antibody_Cat#
A305-041A
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5952
5953
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV44-59
BGKcLV44-60
Sample_ID
BGKcLV44-59
BGKcLV44-60
Sample Name
Sample Name
RBP
RPS15
RPS15
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2024-10-08
2024-10-08
Project
ENCORE2
ENCORE2
Note
ID
13656
13657
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back