PRPF39      CRISPR in K562      Control: NT-BGKcLV44-1,NT-BGKcLV44-2

General Information
RBPPRPF39
Cell_LineK562
MethodCRISPR
Exp_NamePRPF39-BGKcLV44-K562
ENCODE_series_ID
Batch_IDBGKcLV44
Pool IDPool-241015
Local_Set_Nameset75
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1PRPF39-BGKcLV44-45
Rep2PRPF39-BGKcLV44-46
CN1NT-BGKcLV44-1
CN2NT-BGKcLV44-2
Rep1_qPCR19.0
Rep2_qPCR0.0
Rep1_WB67.4
Rep2_WB71.8
Antibody Cat#PA5-21627
Antibody Lot#UC2743613B
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1604




Experiment Information (Status: Submitting)
BGKcLV44-45BGKcLV44-46
idx00
TRCN#_or_BGC#BGC#0000451BGC#0000451
shRNA_or_gRNA_sequenceGCCCAAAGCATATGCACCATGCCCAAAGCATATGCACCAT
PAMGGGGGG
NamePRPF39_80PRPF39_80
Sample_IDBGKcLV44-45BGKcLV44-46
transduction_Date7/30/247/30/24
daysD6D6
RBP_namePRPF39PRPF39
qPCR_result19.00.0
Ave_qPCR9.5
RT-qPCR_primer-Fcttgaagattttggttccgatgt
RT-qPCR_primer-Rtgtgctttcttttcctctggt
protein_conc42204355
WB_result67.471.8
Ave_WB69.6
WB_DONE_date8/12/24,8/22/24need discussion
MW78KD
IP
antibody_Cat#PA5-21627UC2743613B
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID59345935




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
PRPF39Product_ID: PA5-21627
Lot_ID: UC2743613B
Source: Thermo Fisher
Target Name: PRPF39-human
ThermoFisher_PA5-21627_UC2743613B_PRPF39.png<br>Caption: IP-WB analysis of K562 whole cell lysate using the PRPF39 specific antibody, PA5-21627. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the PRPF39-specific antibody, PA5-21627. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
PRPF39-K562-CRISPR-PA5-21627.png<br>Caption: Western blot following CRISPR against PRPF39 in K562 whole cell lysate using PRPF39 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against PRPF39. PRPF39 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV44-45BGKcLV44-46
Sample_IDBGKcLV44-45BGKcLV44-46
Sample Name
Sample NamePRPF39-BGKcLV44-45PRPF39-BGKcLV44-46
RBPPRPF39PRPF39
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-112025-02-11
ProjectENCORE2ENCORE2
Note
ID1360013601




Library-Prep Information
BGKcLV44-45BGKcLV44-46
Sample #2930
Sample NamePRPF39-BGKcLV44-45PRPF39-BGKcLV44-46
Sample_Name_Alias
Index Well PositionE09F09
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2024-10-102024-10-10
Lib_IDLib-241010Lib-241010
Tecan_Location
Tecan
Tecan_date
Size_bp300291
Peak_Molarity67.3067.80
libSampleQC_DNA_WellDNA_Library_set75/set1/E9.pngDNA_Library_set75/set1/F9.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set75/set1/E3.pngRNA_Library_set75/set1/F3.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-10-152024-10-15
Sample_IDBGKcLV44-45BGKcLV44-46
RBPPRPF39PRPF39
Batch_IDBGKcLV44BGKcLV44
WB_result67.40071.800
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID45884589




Sequencing Information
BGKcLV44-45BGKcLV44-46
Sample_IDBGKcLV44-45BGKcLV44-46
Sample NamePRPF39-BGKcLV44-45PRPF39-BGKcLV44-46
Pool IDPool-241015Pool-241015
LocalServer_folderset75set75
total_reads41,584,20235,860,243
total_aligned_reads39,759,73133,604,783
unique_aligned_reads36,870,68931,250,602
percent_uniqueAligned0.886650.87146
correlation_replicates0.9972350.997235
spikein_reads67,57047,280
percent_spikeins0.001620.00132
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID32993300




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
PRPF39-BGKcLV44-45_S21_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3299NovaSeq6000100paired-ended1NT-BGKcLV44-1_S1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230956
PRPF39-BGKcLV44-45_S21_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3299NovaSeq6000100paired-ended2NT-BGKcLV44-1_S1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230998
PRPF39-BGKcLV44-45_Aligned.sortedByCoord.out.bamENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3299GRCh38V40PRPF39-BGKcLV44-45_S21_L001_R1_001.filtered.trimmed.paired.fastq.gz,PRPF39-BGKcLV44-45_S21_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231040
PRPF39-BGKcLV44-45_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3299GRCh38V40PRPF39-BGKcLV44-45_Aligned.sortedByCoord.out.bamENCORE231082
PRPF39-BGKcLV44-45_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3299GRCh38V40PRPF39-BGKcLV44-45_Aligned.sortedByCoord.out.bamENCORE231124
PRPF39-BGKcLV44-45_Signal.Unique.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3299GRCh38V40PRPF39-BGKcLV44-45_Aligned.sortedByCoord.out.bamENCORE231166
PRPF39-BGKcLV44-45_Signal.Unique.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3299GRCh38V40PRPF39-BGKcLV44-45_Aligned.sortedByCoord.out.bamENCORE231208
PRPF39-BGKcLV44-45_quant.sfENCODE_DATA/set75/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3299GRCh38V40PRPF39-BGKcLV44-45_S21_L001_R1_001.filtered.trimmed.paired.fastq.gz,PRPF39-BGKcLV44-45_S21_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231250
PRPF39-BGKcLV44-46_S22_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3300NovaSeq6000100paired-ended1NT-BGKcLV44-1_S1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230957
PRPF39-BGKcLV44-46_S22_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3300NovaSeq6000100paired-ended2NT-BGKcLV44-1_S1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230999
PRPF39-BGKcLV44-46_Aligned.sortedByCoord.out.bamENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3300GRCh38V40PRPF39-BGKcLV44-46_S22_L001_R1_001.filtered.trimmed.paired.fastq.gz,PRPF39-BGKcLV44-46_S22_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231041
PRPF39-BGKcLV44-46_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3300GRCh38V40PRPF39-BGKcLV44-46_Aligned.sortedByCoord.out.bamENCORE231083
PRPF39-BGKcLV44-46_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3300GRCh38V40PRPF39-BGKcLV44-46_Aligned.sortedByCoord.out.bamENCORE231125
PRPF39-BGKcLV44-46_Signal.Unique.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3300GRCh38V40PRPF39-BGKcLV44-46_Aligned.sortedByCoord.out.bamENCORE231167
PRPF39-BGKcLV44-46_Signal.Unique.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3300GRCh38V40PRPF39-BGKcLV44-46_Aligned.sortedByCoord.out.bamENCORE231209
PRPF39-BGKcLV44-46_quant.sfENCODE_DATA/set75/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3300GRCh38V40PRPF39-BGKcLV44-46_S22_L001_R1_001.filtered.trimmed.paired.fastq.gz,PRPF39-BGKcLV44-46_S22_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231251