DIAPH1      CRISPR in K562      Batch: BGKcLV38

Experiment Information (Status: NotSatisfied)
BGKcLV38-11BGKcLV38-11BGKcLV38-11BGKcLV38-12BGKcLV38-12BGKcLV38-12
idx142814280142914290
TRCN#_or_BGC#BGC#0000921BGC#0000921BGC#0000921BGC#0000921BGC#0000921BGC#0000921
shRNA_or_gRNA_sequenceCGGGACATGGAGCCGCCCGGCGGGACATGGAGCCGCCCGGCGGGACATGGAGCCGCCCGGCGGGACATGGAGCCGCCCGGCGGGACATGGAGCCGCCCGGCGGGACATGGAGCCGCCCGG
PAMcggcggcggcggcggcgg
NameDIAPH1_89DIAPH1_89DIAPH1_89DIAPH1_89DIAPH1_89DIAPH1_89
Sample_IDBGKcLV38-11BGKcLV38-11BGKcLV38-11BGKcLV38-12BGKcLV38-12BGKcLV38-12
transduction_Date10/18/2210/18/2210/18/2210/18/2210/18/2210/18/22
daysD6D6D6D6D6D6
RBP_nameDIAPH1DIAPH1DIAPH1DIAPH1DIAPH1DIAPH1
qPCR_result33.533.533.520.720.720.7
Ave_qPCR27.127.127.1
RT-qPCR_primer-Fcagcaaattgccacagagaacagcaaattgccacagagaacagcaaattgccacagagaa
RT-qPCR_primer-Rtcttggcatcttccagttcctcttggcatcttccagttcctcttggcatcttccagttcc
protein_conc298929892989357235723572
WB_result61.460.989.768.670.586.1
Ave_WB65.065.7
WB_DONE_date10/26/227/19/232/29/24
MW142KD142KD142KD
IP
antibody_Cat#A300-078AA300-077A14634Slot# 1lot# 2lot# 2
Antibody DCC ID
submitted_to_DCC_datesubmittedsubmitted
Rep1_TPM000000
Rep2_TPM000000
ActionReadyReady
Library_start_date
repeat_library
Note
ID560256045606560356055607




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
DIAPH1Product_ID: A300-078A
Lot_ID: 1
Source: Bethyl Labs
Target Name: DIAPH1-human
DIAPH1-HEPG2-CRISPR-A300-078A.png<br>Caption: Western blot following CRISPR against DIAPH1 in HepG2 whole cell lysate using DIAPH1 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against DIAPH1. DIAPH1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
DIAPH1-K562-CRISPR-A300-078A.png<br>Caption: Western blot following CRISPR against DIAPH1 in K562 whole cell lysate using DIAPH1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against DIAPH1. DIAPH1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
DIAPH1Product_ID: A300-077A
Lot_ID: 2
Source: Bethyl Labs
Target Name: DIAPH1-human
DIAPH1-K562-CRISPR-A300-077A.png<br>Caption: Western blot following CRISPR against DIAPH1 in K562 whole cell lysate using DIAPH1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against DIAPH1. DIAPH1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
DIAPH1Product_ID: 14634S
Lot_ID: 2
Source: Cell Signaling
Target Name: DIAPH1-human
DIAPH1-K562-CRISPR-14634S.png<br>Caption: Western blot following CRISPR against DIAPH1 in K562 whole cell lysate using DIAPH1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against DIAPH1. DIAPH1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV38-11BGKcLV38-12
Sample_IDBGKcLV38-11BGKcLV38-12
Sample Name
Sample Name
RBPDIAPH1DIAPH1
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-01-032023-01-03
ProjectENCORE2ENCORE2
Note
ID1102411025




Library-Prep Information
BGKcLV38-11BGKcLV38-12
Sample #5960
Sample NameDIAPH1-BGKcLV38-11DIAPH1-BGKcLV38-12
Sample_Name_Alias
Index Well PositionA09B09
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2023-01-192023-01-19
Lib_IDLib-230119Lib-230119
Tecan_Location
Tecan
Tecan_date
Size_bp295305
Peak_Molarity4.4153.50
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
SampleQC_date2023-01-272023-01-27
Sample_IDBGKcLV38-11BGKcLV38-12
RBPDIAPH1DIAPH1
Batch_IDBGKcLV38BGKcLV38
WB_result61.40068.600
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusNotToSequenceNotToSequence
ProjectENCORE2ENCORE2
ID34303431




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database