ZC3H8      shRNA in HepG2      Control: NT-BGHLV37-D

General Information
RBPZC3H8
Cell_LineHepG2
MethodshRNA
Exp_NameZC3H8-BGHLV37-HepG2
ENCODE_series_IDENCSR123ZDP
Batch_IDBGHLV37
Pool IDPool-181119
Local_Set_Nameset41_spikeins
ENCODE_KD_Exp_IDENCSR184YDW
ENCODE_CN_Exp_IDENCSR093ERJ
Rep1ZC3H8-BGHLV37-115D
Rep2ZC3H8-BGHLV37-116D
CN1NT-BGHLV37-1D
CN2NT-BGHLV37-2D
Rep1_qPCR66.8
Rep2_qPCR64.0
Rep1_WB54.3
Rep2_WB58.8
Antibody Cat#A303-089A
Antibody Lot#A303-089A
Antibody DCC IDENCAB192ZJZ
StatusReleased
ProjectENCODE4
ID883




Experiment Information (Status: NotSatisfied)
BGHLV37-117BGHLV37-118
idx10291030
TRCN#_or_BGC#TRCN0000160217TRCN0000160217
shRNA_or_gRNA_sequenceCATTGGTAGATGGACCATAAACATTGGTAGATGGACCATAAA
PAM
NameZC3H8ZC3H8
Sample_IDBGHLV37-117BGHLV37-118
transduction_Date9/1/169/1/16
days
RBP_nameZC3H8ZC3H8
qPCR_resultcell deadcell dead
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc00
WB_result
Ave_WB
WB_DONE_date
MW34kd
IP11
antibody_Cat#A303-089AA303-089A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM19.20
Rep2_TPM17.50
Action
Library_start_date
repeat_library
Note
ID31283129




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV37-117BGHLV37-118
Sample_IDBGHLV37-117BGHLV37-118
Sample Name
Sample Name
RBPZC3H8ZC3H8
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID23292330




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database