Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
ANXA2
shRNA
in HepG2
Batch: BGHLV30
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV30-9
BGHLV30-10
idx
693
694
TRCN#_or_BGC#
TRCN0000056144
TRCN0000056144
shRNA_or_gRNA_sequence
GCAGGAAATTAACAGAGTCTA
GCAGGAAATTAACAGAGTCTA
PAM
Name
ANXA2
ANXA2
Sample_ID
BGHLV30-9
BGHLV30-10
transduction_Date
8/25/2015
8/25/2015
days
RBP_name
ANXA2
ANXA2
qPCR_result
76.3
76.0
Ave_qPCR
76.2
RT-qPCR_primer-F
caggatattgccttcgccta
RT-qPCR_primer-R
caaaatcaccgtctccaggt
protein_conc
3936
4421
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
9/4/2015
MW
39kDa
IP
1
1
antibody_Cat#
GTX100046
GTX100046
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
58.5
0
Rep2_TPM
39.8
0
Action
Library_start_date
repeat_library
Note
ID
2784
2785
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV30-9
BGHLV30-10
Sample_ID
BGHLV30-9
BGHLV30-10
Sample Name
Sample Name
RBP
ANXA2
ANXA2
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2121
2122
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back