MAK16      shRNA in HepG2      Batch: BGHLV20

Experiment Information (Status: NotSatisfied)
BGHLV20-43BGHLV20-44
idx407408
TRCN#_or_BGC#TRCN0000137397TRCN0000137397
shRNA_or_gRNA_sequenceGAGGTAGATGAGAGTGACATAGAGGTAGATGAGAGTGACATA
PAM
NameMAK16_97MAK16_97
Sample_IDBGHLV20-43BGHLV20-44
transduction_Date10/2/201410/2/2014
days
RBP_nameMAK16MAK16
qPCR_result41.126.2
Ave_qPCR33.6
RT-qPCR_primer-Fatgccactattaaagaagagaaagga
RT-qPCR_primer-Raggaaaagccgctcgttcta
protein_conc26812745
WB_resultredo transfectionredo transfection
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#A301-232AA301-232A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM9.50
Rep2_TPM8.30
Action
Library_start_date
repeat_library
Note
ID24762477




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV20-43BGHLV20-44
Sample_IDBGHLV20-43BGHLV20-44
Sample Name
Sample Name
RBPMAK16MAK16
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID19691970




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database