EIF4A2      CRISPR in K562      Batch: BGKcLV51

Experiment Information (Status: Experimented)
BGKcLV51-53BGKcLV51-54
idx00
TRCN#_or_BGC#BGC#0001465BGC#0001465
shRNA_or_gRNA_sequenceCTTTTCAGTCGGGCGCTGAGCTTTTCAGTCGGGCGCTGAG
PAMTGGTGG
NameEIF4A2_74UEIF4A2_74U
Sample_IDBGKcLV51-53BGKcLV51-54
transduction_Date9/30/20259/30/2025
daysD6D6
RBP_nameEIF4A2EIF4A2
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc25622644
WB_result
Ave_WB
WB_DONE_date10/22/25
MW46 kDa#12
IP
antibody_Cat#GTX107484lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID62736274




Western Blot
Western Blot info was not avaliable




Experiment Status
Sample_ID
Sample Name
Sample Name
RBP
Cell_Line
Exp UID
Status
Status_date
Project
Note
ID




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database