AGO2      CRISPR in K562      Batch: BGKcLV48

Experiment Information (Status: NotSatisfied)
BGKcLV48-7BGKcLV48-8
idx00
TRCN#_or_BGC#BGC#0000077BGC#0000077
shRNA_or_gRNA_sequenceGAGGTCCCAAAGTCGGGTCTGAGGTCCCAAAGTCGGGTCT
PAMAGGAGG
NameAGO2()_86_3AGO2()_86_3
Sample_IDBGKcLV48-7BGKcLV48-8
transduction_Date4/15/254/15/25
daysD6D6
RBP_nameAGO2AGO2
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc20952458
WB_resultno clear band on the position
Ave_WB
WB_DONE_date4/28/25
MW97KD
IPRabbitMonoclonal
antibody_Cat#MA5-14861
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM15.40
Rep2_TPM16.70
Action
Library_start_date
repeat_library
Note
ID61386139




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV48-7BGKcLV48-8
Sample_IDBGKcLV48-7BGKcLV48-8
Sample Name
Sample Name
RBPAGO2AGO2
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-08-062025-08-06
ProjectENCORE2ENCORE2
Note
ID1426414265




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database