Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RPL8
CRISPR
in K562
Batch: BGKcLV48
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequenced
)
BGKcLV48-63
BGKcLV48-64
idx
0
0
TRCN#_or_BGC#
BGC#0001373
BGC#0001373
shRNA_or_gRNA_sequence
GTGGATTTCGCTGAGCGGCA
GTGGATTTCGCTGAGCGGCA
PAM
CGG
CGG
Name
RPL8_93
RPL8_93
Sample_ID
BGKcLV48-63
BGKcLV48-64
transduction_Date
4/15/25
4/15/25
days
D6
D6
RBP_name
RPL8
RPL8
qPCR_result
69.6
70.3
Ave_qPCR
70.0
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
1925
1912
WB_result
78.1
60.8
Ave_WB
WB_DONE_date
5/14/25
MW
28KD
IP
antibody_Cat#
A305-059A
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
6196
6197
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
RPL8
Product_ID:
A305-059A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RPL8-human
Experiment Status
BGKcLV48-63
BGKcLV48-64
Sample_ID
BGKcLV48-63
BGKcLV48-64
Sample Name
Sample Name
RPL8-BGKcLV48-63
RPL8-BGKcLV48-64
RBP
RPL8
RPL8
Cell_Line
K562
K562
Exp UID
Status
Sequenced
Sequenced
Status_date
2025-10-02
2025-10-02
Project
ENCORE2
ENCORE2
Note
ID
14252
14253
Library-Prep
Sequencing
Library-Prep Information
BGKcLV48-63
BGKcLV48-64
Sample #
15
16
Sample Name
RPL8-BGKcLV48-63
RPL8-BGKcLV48-64
Sample_Name_Alias
Index Well Position
G02
H02
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-08-18
2025-08-18
Lib_ID
Lib-250818
Lib-250818
Tecan_Location
Tecan
Tecan_date
Size_bp
264
262
Peak_Molarity
63.40
58.10
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-08-19
2025-08-19
Sample_ID
BGKcLV48-63
BGKcLV48-64
RBP
RPL8
RPL8
Batch_ID
BGKcLV48
BGKcLV48
WB_result
78.100
60.800
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4760
4761
Sequencing Information
BGKcLV48-63
BGKcLV48-64
Sample_ID
BGKcLV48-63
BGKcLV48-64
Sample Name
RPL8-BGKcLV48-63
RPL8-BGKcLV48-64
Pool ID
Pool-250822
Pool-250822
LocalServer_folder
total_reads
0
0
total_aligned_reads
0
0
unique_aligned_reads
0
0
percent_uniqueAligned
correlation_replicates
spikein_reads
0
0
percent_spikeins
original_ReadLength
QC_Status
ReadyToQC
ReadyToQC
ID
3463
3464
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back