RNH1      CRISPR in K562      Batch: BGKcLV48

Experiment Information (Status: Sequenced)
BGKcLV48-59BGKcLV48-60
idx00
TRCN#_or_BGC#BGC#0001371BGC#0001371
shRNA_or_gRNA_sequenceCCTTGCACCGTGCTTCCGTGCCTTGCACCGTGCTTCCGTG
PAMAGGAGG
NameRNH1_90RNH1_90
Sample_IDBGKcLV48-59BGKcLV48-60
transduction_Date4/15/254/15/25
daysD6D6
RBP_nameRNH1RNH1
qPCR_result62.362.8
Ave_qPCR62.6
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc20082021
WB_result58.056.7
Ave_WB
WB_DONE_date5/14/25
MW50KD
IP
antibody_Cat#A305-357ALOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID61926193




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
RNH1Product_ID: A305-357A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RNH1-human
RNH1-HEPG2-A305-357A.png<br>Caption: Western blot following CRISPR against RNH1 in HepG2 whole cell lysate using RNH1 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RNH1. RNH1 protein appears as the green arrow, Tubulin serves as a control and appears in red arrow.
Bethyl_A305-357A_1_RNH1.png<br>Caption: IP-WB analysis of K562 whole cell lysate using the RNH1 specific antibody, A305-357A. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the RNH1-specific antibody, A305-357A. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
RNH1-K562-CRISPR-A305-357A.png<br>Caption: Western blot following CRISPR against RNH1 in K562 whole cell lysate using RNH1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RNH1. RNH1 protein appears as the green arrow, Tubulin serves as a control and appears in red arrow.




Experiment Status
BGKcLV48-59BGKcLV48-60
Sample_IDBGKcLV48-59BGKcLV48-60
Sample Name
Sample NameRNH1-BGKcLV48-59RNH1-BGKcLV48-60
RBPRNH1RNH1
Cell_LineK562K562
Exp UID
StatusSequencedSequenced
Status_date2025-10-022025-10-02
ProjectENCORE2ENCORE2
Note
ID1425014251




Library-Prep Information
BGKcLV48-59BGKcLV48-60
Sample #1314
Sample NameRNH1-BGKcLV48-59RNH1-BGKcLV48-60
Sample_Name_Alias
Index Well PositionE02F02
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2025-08-182025-08-18
Lib_IDLib-250818Lib-250818
Tecan_Location
Tecan
Tecan_date
Size_bp262261
Peak_Molarity108.0074.10
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2025-08-192025-08-19
Sample_IDBGKcLV48-59BGKcLV48-60
RBPRNH1RNH1
Batch_IDBGKcLV48BGKcLV48
WB_result58.00056.700
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID47584759




Sequencing Information
BGKcLV48-59BGKcLV48-60
Sample_IDBGKcLV48-59BGKcLV48-60
Sample NameRNH1-BGKcLV48-59RNH1-BGKcLV48-60
Pool IDPool-250822Pool-250822
LocalServer_folder
total_reads00
total_aligned_reads00
unique_aligned_reads00
percent_uniqueAligned
correlation_replicates
spikein_reads00
percent_spikeins
original_ReadLength
QC_StatusReadyToQCReadyToQC
ID34613462




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database