HNRNPLL      CRISPR in K562      Batch: BGKcLV48

Experiment Information (Status: NotSatisfied)
BGKcLV48-35BGKcLV48-36
idx00
TRCN#_or_BGC#BGC#0001342BGC#0001342
shRNA_or_gRNA_sequenceTATACTGTATGCAACCCTGTTATACTGTATGCAACCCTGT
PAMTGGTGG
NameHNRNPLL-82HNRNPLL-82
Sample_IDBGKcLV48-35BGKcLV48-36
transduction_Date4/15/254/15/25
daysD6D6
RBP_nameHNRNPLLHNRNPLL
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc20052106
WB_result0.00.0
Ave_WB
WB_DONE_date4/24/25
MW61kd#16 Fu's
IP
antibody_Cat##4783lot# 2
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID61666167




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV48-35BGKcLV48-36
Sample_IDBGKcLV48-35BGKcLV48-36
Sample Name
Sample Name
RBPHNRNPLLHNRNPLL
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-08-062025-08-06
ProjectENCORE2ENCORE2
Note
ID1428814289




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database