Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
HNRNPD
CRISPR
in K562
Batch: BGKcLV48
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequenced
)
BGKcLV48-31
BGKcLV48-32
idx
0
0
TRCN#_or_BGC#
BGC#0000192
BGC#0000192
shRNA_or_gRNA_sequence
GTCGGAGGAGCAGTTCGGCG
GTCGGAGGAGCAGTTCGGCG
PAM
GGG
GGG
Name
HNRNPD-93F
HNRNPD-93F
Sample_ID
BGKcLV48-31
BGKcLV48-32
transduction_Date
4/15/25
4/15/25
days
D6
D6
RBP_name
HNRNPD
HNRNPD
qPCR_result
38.0
26.7
Ave_qPCR
32.4
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2399
2552
WB_result
84.8
86.3
Ave_WB
WB_DONE_date
5/1/25
MW
38kd
TUBULIN
IP
fu's #18
antibody_Cat#
#12382
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
6162
6163
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
HNRNPD
Product_ID:
12382S
Lot_ID: 1
Source: Cell Signaling
Target Name: HNRNPD-human
Experiment Status
BGKcLV48-31
BGKcLV48-32
Sample_ID
BGKcLV48-31
BGKcLV48-32
Sample Name
Sample Name
HNRNPD-BGKcLV48-31
HNRNPD-BGKcLV48-32
RBP
HNRNPD
HNRNPD
Cell_Line
K562
K562
Exp UID
Status
Sequenced
Sequenced
Status_date
2025-10-02
2025-10-02
Project
ENCORE2
ENCORE2
Note
ID
14242
14243
Library-Prep
Sequencing
Library-Prep Information
BGKcLV48-31
BGKcLV48-32
Sample #
5
6
Sample Name
HNRNPD-BGKcLV48-31
HNRNPD-BGKcLV48-32
Sample_Name_Alias
Index Well Position
E01
F01
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-08-18
2025-08-18
Lib_ID
Lib-250818
Lib-250818
Tecan_Location
Tecan
Tecan_date
Size_bp
264
248
Peak_Molarity
85.90
92.10
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-08-19
2025-08-19
Sample_ID
BGKcLV48-31
BGKcLV48-32
RBP
HNRNPD
HNRNPD
Batch_ID
BGKcLV48
BGKcLV48
WB_result
84.800
86.300
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4750
4751
Sequencing Information
BGKcLV48-31
BGKcLV48-32
Sample_ID
BGKcLV48-31
BGKcLV48-32
Sample Name
HNRNPD-BGKcLV48-31
HNRNPD-BGKcLV48-32
Pool ID
Pool-250822
Pool-250822
LocalServer_folder
total_reads
0
0
total_aligned_reads
0
0
unique_aligned_reads
0
0
percent_uniqueAligned
correlation_replicates
spikein_reads
0
0
percent_spikeins
original_ReadLength
QC_Status
ReadyToQC
ReadyToQC
ID
3453
3454
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back