fus      CRISPR in K562      Batch: BGKcLV48

Experiment Information (Status: NotSatisfied)
BGKcLV48-29BGKcLV48-30
idx00
TRCN#_or_BGC#BGC#0001337BGC#0001337
shRNA_or_gRNA_sequenceTACGGGGATGATCGTCGTGGTACGGGGATGATCGTCGTGG
PAMTGGTGG
Namefus-97fus-97
Sample_IDBGKcLV48-29BGKcLV48-30
transduction_Date4/15/254/15/25
daysD6D6
RBP_namefusfus
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc21092086
WB_result
Ave_WB
WB_DONE_date4/24/25DONE ON BGKLV13_51
MW53kDa
IP
antibody_Cat#67840Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID61606161




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV48-29BGKcLV48-30
Sample_IDBGKcLV48-29BGKcLV48-30
Sample Name
Sample Name
RBPfusfus
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-08-062025-08-06
ProjectENCORE2ENCORE2
Note
ID1428414285




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database