Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
EIF3E
CRISPR
in K562
Batch: BGKcLV48
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV48-23
BGKcLV48-24
idx
0
0
TRCN#_or_BGC#
BGC#0001330
BGC#0001330
shRNA_or_gRNA_sequence
TTTCAGTTGTGCAACCACTG
TTTCAGTTGTGCAACCACTG
PAM
TGG
TGG
Name
EIF3E_63
EIF3E_63
Sample_ID
BGKcLV48-23
BGKcLV48-24
transduction_Date
4/15/25
4/15/25
days
D6
D6
RBP_name
EIF3E
EIF3E
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2214
2159
WB_result
0.0
0.0
Ave_WB
WB_DONE_date
4/24/25,5/1/25
MW
52KD
IP
antibody_Cat#
A302-985A
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
6154
6155
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV48-23
BGKcLV48-24
Sample_ID
BGKcLV48-23
BGKcLV48-24
Sample Name
Sample Name
RBP
EIF3E
EIF3E
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-08-06
2025-08-06
Project
ENCORE2
ENCORE2
Note
ID
14278
14279
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back