SNUPN      CRISPR in K562      Batch: BGKcLV46

Experiment Information (Status: NotSatisfied)
BGKcLV46-91BGKcLV46-92
idx00
TRCN#_or_BGC#BGC#0001270BGC#0001270
shRNA_or_gRNA_sequenceAGCAGAGTGAGCGCCGCCGGAGCAGAGTGAGCGCCGCCGG
PAMAGGAGG
NameSNUPN_79SNUPN_79
Sample_IDBGKcLV46-91BGKcLV46-92
transduction_Date12/20/2412/20/24
daysD6D6
RBP_nameSNUPNSNUPN
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc45892790
WB_result39.343.4
Ave_WB
WB_DONE_date1/16/25need dscussion
MW41kd
IP
antibody_Cat#A305-567Alot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID61036104




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV46-91BGKcLV46-92
Sample_IDBGKcLV46-91BGKcLV46-92
Sample Name
Sample Name
RBPSNUPNSNUPN
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-02-102025-02-10
ProjectENCORE2ENCORE2
Note
ID1412414125




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database