RPL7      CRISPR in K562      Control: NT-BGKcLV46-1,NT-BGKcLV46-2

General Information
RBPRPL7
Cell_LineK562
MethodCRISPR
Exp_NameRPL7-BGKcLV46-K562
ENCODE_series_ID
Batch_IDBGKcLV46
Pool IDPool-250312
Local_Set_Nameset77
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1RPL7-BGKcLV46-65
Rep2RPL7-BGKcLV46-66
CN1NT-BGKcLV46-1
CN2NT-BGKcLV46-2
Rep1_qPCR68.3
Rep2_qPCR64.0
Rep1_WB52.6
Rep2_WB54.6065
Antibody Cat#A300-741A
Antibody Lot#lot# 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1649




Experiment Information (Status: NotSatisfied)
BGKcLV46-67BGKcLV46-68
idx00
TRCN#_or_BGC#BGC#0001259BGC#0001093
shRNA_or_gRNA_sequenceTTCAGCTTCGAAAGGCAAGGATCATCCACGACCCGGGCCG
PAMAGGCGG
NameRPL7-61RPL8_94
Sample_IDBGKcLV46-67BGKcLV46-68
transduction_Date12/20/2412/20/24
daysD6D6
RBP_nameRPL7RPL8
qPCR_result64.0
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc32463658
WB_result54.60650.0
Ave_WB
WB_DONE_date
MW
IP
antibody_Cat#lot# 1lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReady
Library_start_date
repeat_library
Note
ID60726074




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV46-67BGKcLV46-68
Sample_IDBGKcLV46-67BGKcLV46-68
Sample Name
Sample Name
RBPRPL8RPL8
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-02-102025-02-10
ProjectENCORE2ENCORE2
Note
ID1411014111




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database