FGFR1OP      CRISPR in K562      Batch: BGKcLV46

Experiment Information (Status: NotSatisfied)
BGKcLV46-37BGKcLV46-38
idx00
TRCN#_or_BGC#BGC#0001245BGC#0001245
shRNA_or_gRNA_sequenceTAAAGAAGGGGCTCCCGCCATAAAGAAGGGGCTCCCGCCA
PAMGGGGGG
NameFGFR1OP_87FGFR1OP_87
Sample_IDBGKcLV46-37BGKcLV46-38
transduction_Date12/20/2412/20/24
daysD6D6
RBP_nameFGFR1OPFGFR1OP
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc43894057
WB_result0.00.0
Ave_WB
WB_DONE_date1/2/25,1/6/25
MW
IP
antibody_Cat#A301-861A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID60416042




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV46-37BGKcLV46-38
Sample_IDBGKcLV46-37BGKcLV46-38
Sample Name
Sample Name
RBPFGFR1OPFGFR1OP
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-02-102025-02-10
ProjectENCORE2ENCORE2
Note
ID1409414095




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database