Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
CDC40
CRISPR
in K562
Batch: BGKcLV44
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV44-95
BGKcLV44-96
idx
0
0
TRCN#_or_BGC#
BGC#0000026
BGC#0000026
shRNA_or_gRNA_sequence
GGCTCCGGAGGTGGCAGTTA
GGCTCCGGAGGTGGCAGTTA
PAM
Name
CDC40_71-F
CDC40_71-F
Sample_ID
BGKcLV44-95
BGKcLV44-96
transduction_Date
7/30/24
7/30/24
days
D6
D6
RBP_name
CDC40
CDC40
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
4158
4706
WB_result
Ave_WB
WB_DONE_date
8/22/24,8/28/24
NO BANDON THE POSITI
MW
66
IP
antibody_Cat#
99086S
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5988
5989
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV44-95
BGKcLV44-96
Sample_ID
BGKcLV44-95
BGKcLV44-96
Sample Name
Sample Name
RBP
CDC40
CDC40
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2024-10-08
2024-10-08
Project
ENCORE2
ENCORE2
Note
ID
13680
13681
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back