Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
PABPN1
CRISPR
in K562
Control:
NT-BGKcLV44-1,NT-BGKcLV44-2
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
PABPN1
Cell_Line
K562
Method
CRISPR
Exp_Name
PABPN1-BGKcLV44-K562
ENCODE_series_ID
Batch_ID
BGKcLV44
Pool ID
Pool-241015
Local_Set_Name
set75
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1
PABPN1-BGKcLV44-41
Rep2
PABPN1-BGKcLV44-42
CN1
NT-BGKcLV44-1
CN2
NT-BGKcLV44-2
Rep1_qPCR
73.1
Rep2_qPCR
77.1
Rep1_WB
96.9
Rep2_WB
96.9
Antibody Cat#
14154S
Antibody Lot#
lot # 1
Antibody DCC ID
Status
Submitted
Project
ENCORE2
ID
1603
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV44-43
BGKcLV44-44
idx
0
0
TRCN#_or_BGC#
BGC#0001041
BGC#0001041
shRNA_or_gRNA_sequence
CCATCCCAAAGGGTAAGTAA
CCATCCCAAAGGGTAAGTAA
PAM
AGG
AGG
Name
PABPN1-73
PABPN1-73
Sample_ID
BGKcLV44-43
BGKcLV44-44
transduction_Date
7/30/24
7/30/24
days
D6
D6
RBP_name
PABPN1
PABPN1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3429
3990
WB_result
75.8
67.4
Ave_WB
75.8
WB_DONE_date
8/12/24
MW
IP
antibody_Cat#
14154S
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5932
5933
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV44-43
BGKcLV44-44
Sample_ID
BGKcLV44-43
BGKcLV44-44
Sample Name
Sample Name
RBP
PABPN1
PABPN1
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2024-10-08
2024-10-08
Project
ENCORE2
ENCORE2
Note
ID
13644
13645
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back