PABPN1      CRISPR in K562      Control: NT-BGKcLV44-1,NT-BGKcLV44-2

General Information
RBPPABPN1
Cell_LineK562
MethodCRISPR
Exp_NamePABPN1-BGKcLV44-K562
ENCODE_series_ID
Batch_IDBGKcLV44
Pool IDPool-241015
Local_Set_Nameset75
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1PABPN1-BGKcLV44-41
Rep2PABPN1-BGKcLV44-42
CN1NT-BGKcLV44-1
CN2NT-BGKcLV44-2
Rep1_qPCR73.1
Rep2_qPCR77.1
Rep1_WB96.9
Rep2_WB96.9
Antibody Cat#14154S
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1603




Experiment Information (Status: NotSatisfied)
BGKcLV44-43BGKcLV44-44
idx00
TRCN#_or_BGC#BGC#0001041BGC#0001041
shRNA_or_gRNA_sequenceCCATCCCAAAGGGTAAGTAACCATCCCAAAGGGTAAGTAA
PAMAGGAGG
NamePABPN1-73PABPN1-73
Sample_IDBGKcLV44-43BGKcLV44-44
transduction_Date7/30/247/30/24
daysD6D6
RBP_namePABPN1PABPN1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc34293990
WB_result75.867.4
Ave_WB75.8
WB_DONE_date8/12/24
MW
IP
antibody_Cat#14154Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID59325933




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV44-43BGKcLV44-44
Sample_IDBGKcLV44-43BGKcLV44-44
Sample Name
Sample Name
RBPPABPN1PABPN1
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2024-10-082024-10-08
ProjectENCORE2ENCORE2
Note
ID1364413645




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database