MAPK3      CRISPR in K562      Batch: BGKcLV44

Experiment Information (Status: NotSatisfied)
BGKcLV44-33BGKcLV44-34
idx00
TRCN#_or_BGC#BGC#0001156BGC#0001156
shRNA_or_gRNA_sequenceAAGGGGCAGCCGTTCGACGTAAGGGGCAGCCGTTCGACGT
PAMGGGGGG
NameMAPK3_98MAPK3_98
Sample_IDBGKcLV44-33BGKcLV44-34
transduction_Date7/30/247/30/24
daysD6D6
RBP_nameMAPK3MAPK3
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc45684988
WB_result0.00.0
Ave_WB0.0
WB_DONE_date8/12/24
MW42,44kd
IP
antibody_Cat#4695Slot # 28
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID59225923




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV44-33BGKcLV44-34
Sample_IDBGKcLV44-33BGKcLV44-34
Sample Name
Sample Name
RBPMAPK3MAPK3
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2024-10-082024-10-08
ProjectENCORE2ENCORE2
Note
ID1364013641




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database