SESN2      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPSESN2
Cell_LineK562
MethodCRISPR
Exp_NameSESN2-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1SESN2-BGKcLV42-87
Rep2SESN2-BGKcLV42-88
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR0.0
Rep2_qPCR0.0
Rep1_WB98.4
Rep2_WB92.4
Antibody Cat#8487S
Antibody Lot#lot # 3
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1560




Experiment Information (Status: Submitting)
BGKcLV42-87BGKcLV42-88
idx00
TRCN#_or_BGC#BGC#0001186BGC#0001186
shRNA_or_gRNA_sequenceTGTAGCGGGTGATGGCACGGTGTAGCGGGTGATGGCACGG
PAMAGGAGG
NameSESN2_81SESN2_81
Sample_IDBGKcLV42-87BGKcLV42-88
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameSESN2SESN2
qPCR_result0.00.0
Ave_qPCR0.0
RT-qPCR_primer-Fcgctttgagctggagaagtc
RT-qPCR_primer-Rtccgaaagtagggtcttcca
protein_conc14661571
WB_result98.492.4
Ave_WB95.4
WB_DONE_date5/10/24
MW56kd
IP
antibody_Cat#8487Slot # 3
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID58655866




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
SESN2Product_ID: 8487S
Lot_ID: 3
Source: Cell Signaling Technology
Target Name: SESN2-human
CST_8487S_3_SESN2.png<br>Caption: IP-WB analysis of 8487S whole cell lysate using the SESN2 specific antibody, 8487S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the SESN2-specific antibody, 8487S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
SESN2-K562-CRISPR-8487S.png<br>Caption: Western blot following CRISPR against SESN2 in K562 whole cell lysate using SESN2 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against SESN2. SESN2 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-87BGKcLV42-88
Sample_IDBGKcLV42-87BGKcLV42-88
Sample Name
Sample NameSESN2-BGKcLV42-87SESN2-BGKcLV42-88
RBPSESN2SESN2
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1311413115




Library-Prep Information
BGKcLV42-87BGKcLV42-88
Sample #7172
Sample NameSESN2-BGKcLV42-87SESN2-BGKcLV42-88
Sample_Name_Alias
Index Well PositionG09H09
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp294304
Peak_Molarity45.8076.70
libSampleQC_DNA_WellDNA_Library_set73/set1/G9.pngDNA_Library_set73/set1/H9.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set73/set1/G9.pngRNA_Library_set73/set1/H9.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-87BGKcLV42-88
RBPSESN2SESN2
Batch_IDBGKcLV42BGKcLV42
WB_result98.40092.400
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID43404341




Sequencing Information
BGKcLV42-87BGKcLV42-88
Sample_IDBGKcLV42-87BGKcLV42-88
Sample NameSESN2-BGKcLV42-87SESN2-BGKcLV42-88
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads71,745,66833,443,367
total_aligned_reads58,661,11326,619,261
unique_aligned_reads54,031,84224,601,465
percent_uniqueAligned0.753100.73562
correlation_replicates0.9954540.995454
spikein_reads10,4885,750
percent_spikeins0.000150.00017
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID32073208




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
SESN2-BGKcLV42-87_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3207NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230410
SESN2-BGKcLV42-87_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3207NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230500
SESN2-BGKcLV42-87_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3207GRCh38V40SESN2-BGKcLV42-87_L001_R1_001.filtered.trimmed.paired.fastq.gz,SESN2-BGKcLV42-87_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231342
SESN2-BGKcLV42-87_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3207GRCh38V40SESN2-BGKcLV42-87_Aligned.sortedByCoord.out.bamENCORE231432
SESN2-BGKcLV42-87_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3207GRCh38V40SESN2-BGKcLV42-87_Aligned.sortedByCoord.out.bamENCORE231522
SESN2-BGKcLV42-87_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3207GRCh38V40SESN2-BGKcLV42-87_Aligned.sortedByCoord.out.bamENCORE231612
SESN2-BGKcLV42-87_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3207GRCh38V40SESN2-BGKcLV42-87_Aligned.sortedByCoord.out.bamENCORE231702
SESN2-BGKcLV42-87_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3207GRCh38V40SESN2-BGKcLV42-87_L001_R1_001.filtered.trimmed.paired.fastq.gz,SESN2-BGKcLV42-87_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231792
SESN2-BGKcLV42-88_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3208NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230411
SESN2-BGKcLV42-88_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3208NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230501
SESN2-BGKcLV42-88_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3208GRCh38V40SESN2-BGKcLV42-88_L001_R1_001.filtered.trimmed.paired.fastq.gz,SESN2-BGKcLV42-88_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231343
SESN2-BGKcLV42-88_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3208GRCh38V40SESN2-BGKcLV42-88_Aligned.sortedByCoord.out.bamENCORE231433
SESN2-BGKcLV42-88_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3208GRCh38V40SESN2-BGKcLV42-88_Aligned.sortedByCoord.out.bamENCORE231523
SESN2-BGKcLV42-88_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3208GRCh38V40SESN2-BGKcLV42-88_Aligned.sortedByCoord.out.bamENCORE231613
SESN2-BGKcLV42-88_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3208GRCh38V40SESN2-BGKcLV42-88_Aligned.sortedByCoord.out.bamENCORE231703
SESN2-BGKcLV42-88_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3208GRCh38V40SESN2-BGKcLV42-88_L001_R1_001.filtered.trimmed.paired.fastq.gz,SESN2-BGKcLV42-88_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231793