RBMX      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPRBMX
Cell_LineK562
MethodCRISPR
Exp_NameRBMX-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1RBMX-BGKcLV42-81
Rep2RBMX-BGKcLV42-82
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR38.3
Rep2_qPCR26.1
Rep1_WB56.6
Rep2_WB68.4
Antibody Cat#14794S
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1558




Experiment Information (Status: Submitting)
BGKcLV42-81BGKcLV42-82
idx00
TRCN#_or_BGC#BGC#0001180BGC#0001180
shRNA_or_gRNA_sequenceATTTTTGATGCAGATGACGGATTTTTGATGCAGATGACGG
PAMTGGTGG
NameRBMX_83RBMX_83
Sample_IDBGKcLV42-81BGKcLV42-82
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameRBMXRBMX
qPCR_result38.326.1
Ave_qPCR32.2
RT-qPCR_primer-Fcattggtgggcttaatacgg
RT-qPCR_primer-Rttgttggtttcacggtctttc
protein_conc26792313
WB_result56.668.4
Ave_WB62.5
WB_DONE_date5/10/24,5/23/24
MW42kd
IP
antibody_Cat#14794Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID58595860




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
RBMXProduct_ID: 14794S
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: RBMX-human
RBMX-HEPG2-CRISPR-14794S.png<br>Caption: Western blot following CRISPR against RBMX in HepG2 whole cell lysate using RBMX specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RBMX. RBMX protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
CST_14794S_1_RBMX.png<br>Caption: IP-WB analysis of 14794S whole cell lysate using the RBMX specific antibody, 14794S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the RBMX-specific antibody, 14794S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
RBMX-K562-CRISPR-14794S.png<br>Caption: Western blot following CRISPR against RBMX in K562 whole cell lysate using RBMX specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RBMX. RBMX protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-81BGKcLV42-82
Sample_IDBGKcLV42-81BGKcLV42-82
Sample Name
Sample NameRBMX-BGKcLV42-81RBMX-BGKcLV42-82
RBPRBMXRBMX
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1311013111




Library-Prep Information
BGKcLV42-81BGKcLV42-82
Sample #6768
Sample NameRBMX-BGKcLV42-81RBMX-BGKcLV42-82
Sample_Name_Alias
Index Well PositionC09D09
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp310314
Peak_Molarity85.0087.10
libSampleQC_DNA_WellDNA_Library_set73/set1/C9.pngDNA_Library_set73/set1/D9.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set73/set1/C9.pngRNA_Library_set73/set1/D9.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-81BGKcLV42-82
RBPRBMXRBMX
Batch_IDBGKcLV42BGKcLV42
WB_result56.60068.400
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID43364337




Sequencing Information
BGKcLV42-81BGKcLV42-82
Sample_IDBGKcLV42-81BGKcLV42-82
Sample NameRBMX-BGKcLV42-81RBMX-BGKcLV42-82
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads54,454,51439,924,783
total_aligned_reads49,909,85734,334,315
unique_aligned_reads46,024,58931,678,442
percent_uniqueAligned0.845190.79345
correlation_replicates0.9961840.996184
spikein_reads5621,520
percent_spikeins0.000010.00004
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID32033204




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
RBMX-BGKcLV42-81_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3203NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230406
RBMX-BGKcLV42-81_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3203NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230496
RBMX-BGKcLV42-81_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3203GRCh38V40RBMX-BGKcLV42-81_L001_R1_001.filtered.trimmed.paired.fastq.gz,RBMX-BGKcLV42-81_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231338
RBMX-BGKcLV42-81_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3203GRCh38V40RBMX-BGKcLV42-81_Aligned.sortedByCoord.out.bamENCORE231428
RBMX-BGKcLV42-81_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3203GRCh38V40RBMX-BGKcLV42-81_Aligned.sortedByCoord.out.bamENCORE231518
RBMX-BGKcLV42-81_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3203GRCh38V40RBMX-BGKcLV42-81_Aligned.sortedByCoord.out.bamENCORE231608
RBMX-BGKcLV42-81_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3203GRCh38V40RBMX-BGKcLV42-81_Aligned.sortedByCoord.out.bamENCORE231698
RBMX-BGKcLV42-81_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3203GRCh38V40RBMX-BGKcLV42-81_L001_R1_001.filtered.trimmed.paired.fastq.gz,RBMX-BGKcLV42-81_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231788
RBMX-BGKcLV42-82_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3204NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230407
RBMX-BGKcLV42-82_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3204NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230497
RBMX-BGKcLV42-82_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3204GRCh38V40RBMX-BGKcLV42-82_L001_R1_001.filtered.trimmed.paired.fastq.gz,RBMX-BGKcLV42-82_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231339
RBMX-BGKcLV42-82_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3204GRCh38V40RBMX-BGKcLV42-82_Aligned.sortedByCoord.out.bamENCORE231429
RBMX-BGKcLV42-82_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3204GRCh38V40RBMX-BGKcLV42-82_Aligned.sortedByCoord.out.bamENCORE231519
RBMX-BGKcLV42-82_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3204GRCh38V40RBMX-BGKcLV42-82_Aligned.sortedByCoord.out.bamENCORE231609
RBMX-BGKcLV42-82_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3204GRCh38V40RBMX-BGKcLV42-82_Aligned.sortedByCoord.out.bamENCORE231699
RBMX-BGKcLV42-82_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3204GRCh38V40RBMX-BGKcLV42-82_L001_R1_001.filtered.trimmed.paired.fastq.gz,RBMX-BGKcLV42-82_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231789