Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RBBP5
CRISPR
in K562
Control:
NT-BGKcLV42-1,NT-BGKcLV42-2
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
RBBP5
Cell_Line
K562
Method
CRISPR
Exp_Name
RBBP5-BGKcLV42-K562
ENCODE_series_ID
Batch_ID
BGKcLV42
Pool ID
Pool-240715
Local_Set_Name
set73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1
RBBP5-BGKcLV42-75
Rep2
RBBP5-BGKcLV42-76
CN1
NT-BGKcLV42-1
CN2
NT-BGKcLV42-2
Rep1_qPCR
65.3
Rep2_qPCR
68.6
Rep1_WB
93.4
Rep2_WB
91.9
Antibody Cat#
13171S
Antibody Lot#
lot # 1
Antibody DCC ID
Status
Submitted
Project
ENCORE2
ID
1556
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV42-77
BGKcLV42-78
idx
0
0
TRCN#_or_BGC#
BGC#0001179
BGC#0001179
shRNA_or_gRNA_sequence
AAATCGGAGTCATCGTCCAC
AAATCGGAGTCATCGTCCAC
PAM
CGG
CGG
Name
RBBP5_93
RBBP5_93
Sample_ID
BGKcLV42-77
BGKcLV42-78
transduction_Date
4/23/24
4/23/24
days
D6
D6
RBP_name
RBBP5
RBBP5
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2124
2211
WB_result
77.7
75.0
Ave_WB
76.3
WB_DONE_date
4/30/24
MW
70kd
IP
antibody_Cat#
13171S
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5853
5854
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV42-77
BGKcLV42-78
Sample_ID
BGKcLV42-77
BGKcLV42-78
Sample Name
Sample Name
RBP
RBBP5
RBBP5
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2024-06-21
2024-06-21
Project
ENCORE2
ENCORE2
Note
ID
13152
13153
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back