Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
PRPF4B
CRISPR
in K562
Batch: BGKcLV42
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV42-71
BGKcLV42-72
idx
0
0
TRCN#_or_BGC#
BGC#0001174
BGC#0001174
shRNA_or_gRNA_sequence
CCCTCGCGGACACTGTCTCC
CCCTCGCGGACACTGTCTCC
PAM
TGG
TGG
Name
PRPF4B_91
PRPF4B_91
Sample_ID
BGKcLV42-71
BGKcLV42-72
transduction_Date
4/23/24
4/23/24
days
D6
D6
RBP_name
PRPF4B
PRPF4B
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2417
2726
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
5/14/24
MW
150kd
IP
antibody_Cat#
8577S
lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5845
5846
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV42-71
BGKcLV42-72
Sample_ID
BGKcLV42-71
BGKcLV42-72
Sample Name
Sample Name
RBP
PRPF4B
PRPF4B
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2024-06-21
2024-06-21
Project
ENCORE2
ENCORE2
Note
ID
13148
13149
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back