ALYREF      CRISPR in K562      Batch: BGKcLV42

Experiment Information (Status: NotSatisfied)
BGKcLV42-5BGKcLV42-6
idx00
TRCN#_or_BGC#BGC#0001109BGC#0001109
shRNA_or_gRNA_sequenceGTCCATTTTGTCGGCCATGGGTCCATTTTGTCGGCCATGG
PAMCGGCGG
NameALYREF_84ALYREF_84
Sample_IDBGKcLV42-5BGKcLV42-6
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameALYREFALYREF
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc26573151
WB_result0.06.0
Ave_WB3.0
WB_DONE_date4/30/24,5/6/24
MW27KD
IP
antibody_Cat#12655Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID57675768




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV42-5BGKcLV42-6
Sample_IDBGKcLV42-5BGKcLV42-6
Sample Name
Sample Name
RBPALYREFALYREF
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2024-06-212024-06-21
ProjectENCORE2ENCORE2
Note
ID1313413135




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database