EIF2AK2      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPEIF2AK2
Cell_LineK562
MethodCRISPR
Exp_NameEIF2AK2-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1EIF2AK2-BGKcLV42-27
Rep2EIF2AK2-BGKcLV42-28
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR76.9
Rep2_qPCR80.4
Rep1_WB70.6
Rep2_WB69.3
Antibody Cat#12297S
Antibody Lot#lot # 3
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1537




Experiment Information (Status: Submitting)
BGKcLV42-27BGKcLV42-28
idx00
TRCN#_or_BGC#BGC#0001130BGC#0001130
shRNA_or_gRNA_sequenceATTATGAACAGTGTGCATCGATTATGAACAGTGTGCATCG
PAMGGGGGG
NameE2AK2_90E2AK2_90
Sample_IDBGKcLV42-27BGKcLV42-28
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameEIF2AK2EIF2AK2
qPCR_result76.980.4
Ave_qPCR78.6
RT-qPCR_primer-Faatgccgcagccaaatta
RT-qPCR_primer-Rttccccatggataatccttct
protein_conc28452846
WB_result70.669.3
Ave_WB70.0
WB_DONE_date5/6/24
MW74kd
IP
antibody_Cat#12297Slot # 3
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID57975798




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
EIF2AK2Product_ID: 12297S
Lot_ID: 3
Source: Cell Signaling Technology
Target Name: EIF2AK2-human
EIF2AK2-HEPG2-CRISPR-12297S.png<br>Caption: Western blot following CRISPR against EIF2AK2 in HepG2 whole cell lysate using EIF2AK2 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF2AK2. EIF2AK2 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
CST_12297S_3_EiF2AK2.png<br>Caption: IP-WB analysis of 12297S whole cell lysate using the EiF2AK2 specific antibody, 12297S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the EiF2AK2-specific antibody, 12297S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
E2AK2-K562-CRISPR-12297S.png<br>Caption: Western blot following CRISPR against EIF2AK2 in K562 whole cell lysate using EIF2AK2 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF2AK2. EIF2AK2 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-27BGKcLV42-28
Sample_IDBGKcLV42-27BGKcLV42-28
Sample Name
Sample NameEIF2AK2-BGKcLV42-27EIF2AK2-BGKcLV42-28
RBPEIF2AK2EIF2AK2
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1306813069




Library-Prep Information
BGKcLV42-27BGKcLV42-28
Sample #2526
Sample NameEIF2AK2-BGKcLV42-27EIF2AK2-BGKcLV42-28
Sample_Name_Alias
Index Well PositionA04B04
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp296296
Peak_Molarity114.00104.00
libSampleQC_DNA_WellDNA_Library_set73/set1/A4.pngDNA_Library_set73/set1/B4.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set73/set1/A4.pngRNA_Library_set73/set1/B4.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-27BGKcLV42-28
RBPEIF2AK2EIF2AK2
Batch_IDBGKcLV42BGKcLV42
WB_result70.60069.300
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID42944295




Sequencing Information
BGKcLV42-27BGKcLV42-28
Sample_IDBGKcLV42-27BGKcLV42-28
Sample NameEIF2AK2-BGKcLV42-27EIF2AK2-BGKcLV42-28
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads44,471,72328,963,620
total_aligned_reads37,197,70726,039,477
unique_aligned_reads34,201,44123,981,831
percent_uniqueAligned0.769060.82800
correlation_replicates0.9956310.995631
spikein_reads5,308936
percent_spikeins0.000120.00003
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID31613162




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
EIF2AK2-BGKcLV42-27_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3161NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230364
EIF2AK2-BGKcLV42-27_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3161NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230454
EIF2AK2-BGKcLV42-27_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3161GRCh38V40EIF2AK2-BGKcLV42-27_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF2AK2-BGKcLV42-27_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231296
EIF2AK2-BGKcLV42-27_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3161GRCh38V40EIF2AK2-BGKcLV42-27_Aligned.sortedByCoord.out.bamENCORE231386
EIF2AK2-BGKcLV42-27_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3161GRCh38V40EIF2AK2-BGKcLV42-27_Aligned.sortedByCoord.out.bamENCORE231476
EIF2AK2-BGKcLV42-27_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3161GRCh38V40EIF2AK2-BGKcLV42-27_Aligned.sortedByCoord.out.bamENCORE231566
EIF2AK2-BGKcLV42-27_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3161GRCh38V40EIF2AK2-BGKcLV42-27_Aligned.sortedByCoord.out.bamENCORE231656
EIF2AK2-BGKcLV42-27_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3161GRCh38V40EIF2AK2-BGKcLV42-27_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF2AK2-BGKcLV42-27_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231746
EIF2AK2-BGKcLV42-28_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3162NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230365
EIF2AK2-BGKcLV42-28_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3162NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230455
EIF2AK2-BGKcLV42-28_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3162GRCh38V40EIF2AK2-BGKcLV42-28_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF2AK2-BGKcLV42-28_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231297
EIF2AK2-BGKcLV42-28_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3162GRCh38V40EIF2AK2-BGKcLV42-28_Aligned.sortedByCoord.out.bamENCORE231387
EIF2AK2-BGKcLV42-28_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3162GRCh38V40EIF2AK2-BGKcLV42-28_Aligned.sortedByCoord.out.bamENCORE231477
EIF2AK2-BGKcLV42-28_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3162GRCh38V40EIF2AK2-BGKcLV42-28_Aligned.sortedByCoord.out.bamENCORE231567
EIF2AK2-BGKcLV42-28_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3162GRCh38V40EIF2AK2-BGKcLV42-28_Aligned.sortedByCoord.out.bamENCORE231657
EIF2AK2-BGKcLV42-28_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3162GRCh38V40EIF2AK2-BGKcLV42-28_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF2AK2-BGKcLV42-28_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231747