CNOT3      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPCNOT3
Cell_LineK562
MethodCRISPR
Exp_NameCNOT3-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1CNOT3-BGKcLV42-17
Rep2CNOT3-BGKcLV42-18
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR8.6
Rep2_qPCR13.4
Rep1_WB84.1
Rep2_WB86.8
Antibody Cat#13300S
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1532




Experiment Information (Status: Submitting)
BGKcLV42-17BGKcLV42-18
idx00
TRCN#_or_BGC#BGC#0001120BGC#0001120
shRNA_or_gRNA_sequenceTGCCTCAAGAAGGTGTCCGATGCCTCAAGAAGGTGTCCGA
PAMGGGGGG
NameCNOT3_90CNOT3_90
Sample_IDBGKcLV42-17BGKcLV42-18
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameCNOT3CNOT3
qPCR_result8.613.4
Ave_qPCR11.0
RT-qPCR_primer-Fgagggagcagcagcagtagt
RT-qPCR_primer-Rctgctcaaagccacctctg
protein_conc13251174
WB_result84.186.8
Ave_WB85.5
WB_DONE_date5/8/24
MW105kd
IP
antibody_Cat#13300Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID57855786




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
CNOT3Product_ID: 13300S
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: CNOT3-human
CNOT3-HEPG2-CRISPR-13300S.png<br>Caption: Western blot following CRISPR against CNOT3 in HepG2 whole cell lysate using CNOT3 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against CNOT3. CNOT3 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
CST_13300S_1_CNOT3.png<br>Caption: IP-WB analysis of 13300S whole cell lysate using the CNOT3 specific antibody, 13300S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the CNOT3-specific antibody, 13300S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
CNOT3-K562-CRISPR-13300S.png<br>Caption: Western blot following CRISPR against CNOT3 in K562 whole cell lysate using CNOT3 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against CNOT3. CNOT3 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-17BGKcLV42-18
Sample_IDBGKcLV42-17BGKcLV42-18
Sample Name
Sample NameCNOT3-BGKcLV42-17CNOT3-BGKcLV42-18
RBPCNOT3CNOT3
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1305813059




Library-Prep Information
BGKcLV42-17BGKcLV42-18
Sample #1516
Sample NameCNOT3-BGKcLV42-17CNOT3-BGKcLV42-18
Sample_Name_Alias
Index Well PositionG02H02
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp297306
Peak_Molarity50.6052.70
libSampleQC_DNA_WellDNA_Library_set73/set1/G2.pngDNA_Library_set73/set1/H2.png
RIN10.09.8
libSample_RNA_WellRNA_Library_set73/set1/G2.pngRNA_Library_set73/set1/H2.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-17BGKcLV42-18
RBPCNOT3CNOT3
Batch_IDBGKcLV42BGKcLV42
WB_result84.10086.800
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID42844285




Sequencing Information
BGKcLV42-17BGKcLV42-18
Sample_IDBGKcLV42-17BGKcLV42-18
Sample NameCNOT3-BGKcLV42-17CNOT3-BGKcLV42-18
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads56,496,60631,200,773
total_aligned_reads47,904,52624,879,022
unique_aligned_reads44,309,40122,932,480
percent_uniqueAligned0.784280.73500
correlation_replicates0.9839820.983982
spikein_reads9,1206,176
percent_spikeins0.000160.00020
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID31513152




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
CNOT3-BGKcLV42-17_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3151NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230352
CNOT3-BGKcLV42-17_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3151NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230442
CNOT3-BGKcLV42-17_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3151GRCh38V40CNOT3-BGKcLV42-17_L001_R1_001.filtered.trimmed.paired.fastq.gz,CNOT3-BGKcLV42-17_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231284
CNOT3-BGKcLV42-17_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3151GRCh38V40CNOT3-BGKcLV42-17_Aligned.sortedByCoord.out.bamENCORE231374
CNOT3-BGKcLV42-17_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3151GRCh38V40CNOT3-BGKcLV42-17_Aligned.sortedByCoord.out.bamENCORE231464
CNOT3-BGKcLV42-17_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3151GRCh38V40CNOT3-BGKcLV42-17_Aligned.sortedByCoord.out.bamENCORE231554
CNOT3-BGKcLV42-17_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3151GRCh38V40CNOT3-BGKcLV42-17_Aligned.sortedByCoord.out.bamENCORE231644
CNOT3-BGKcLV42-17_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3151GRCh38V40CNOT3-BGKcLV42-17_L001_R1_001.filtered.trimmed.paired.fastq.gz,CNOT3-BGKcLV42-17_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231734
CNOT3-BGKcLV42-18_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3152NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230353
CNOT3-BGKcLV42-18_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3152NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230443
CNOT3-BGKcLV42-18_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3152GRCh38V40CNOT3-BGKcLV42-18_L001_R1_001.filtered.trimmed.paired.fastq.gz,CNOT3-BGKcLV42-18_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231285
CNOT3-BGKcLV42-18_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3152GRCh38V40CNOT3-BGKcLV42-18_Aligned.sortedByCoord.out.bamENCORE231375
CNOT3-BGKcLV42-18_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3152GRCh38V40CNOT3-BGKcLV42-18_Aligned.sortedByCoord.out.bamENCORE231465
CNOT3-BGKcLV42-18_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3152GRCh38V40CNOT3-BGKcLV42-18_Aligned.sortedByCoord.out.bamENCORE231555
CNOT3-BGKcLV42-18_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3152GRCh38V40CNOT3-BGKcLV42-18_Aligned.sortedByCoord.out.bamENCORE231645
CNOT3-BGKcLV42-18_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3152GRCh38V40CNOT3-BGKcLV42-18_L001_R1_001.filtered.trimmed.paired.fastq.gz,CNOT3-BGKcLV42-18_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231735