FNDC3A      CRISPR in K562      Batch: BGKcLV40

Experiment Information (Status: NotSatisfied)
BGKcLV40-57BGKcLV40-58
idx00
TRCN#_or_BGC#BGC#0001023BGC#0001023
shRNA_or_gRNA_sequenceACGGGTGAGTACATATGACGACGGGTGAGTACATATGACG
PAMTGGTGG
NameFNDC3A_90FNDC3A_90
Sample_IDBGKcLV40-57BGKcLV40-58
transduction_Date10/31/2310/31/23
daysD6D6
RBP_nameFNDC3AFNDC3A
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc35063143
WB_result0.00.0
Ave_WB0.0
WB_DONE_date11/17/23
MW132kd
IP
antibody_Cat#A305-158Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID57485749




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV40-57BGKcLV40-58
Sample_IDBGKcLV40-57BGKcLV40-58
Sample Name
Sample Name
RBPFNDC3AFNDC3A
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-12-152023-12-15
ProjectENCORE2ENCORE2
Note
ID1282612827




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database