EIF4G3      CRISPR in K562      Batch: BGKcLV38

Experiment Information (Status: NotSatisfied)
BGKcLV38-63BGKcLV38-64
idx14801481
TRCN#_or_BGC#BGC#0000983BGC#0000983
shRNA_or_gRNA_sequenceTGGGGCACTGGGTACGGCATTGGGGCACTGGGTACGGCAT
PAMGGGGGG
NameEIF4G3_90EIF4G3_90
Sample_IDBGKcLV38-63BGKcLV38-64
transduction_Date10/18/2210/18/22
daysD6D6
RBP_nameEIF4G3EIF4G3
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc38523236
WB_resultno clear band on the position
Ave_WB
WB_DONE_date11/4/22
MW177KD
IP
antibody_Cat#A301-769A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID56745675




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV38-63BGKcLV38-64
Sample_IDBGKcLV38-63BGKcLV38-64
Sample Name
Sample Name
RBPEIF4G3EIF4G3
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-01-032023-01-03
ProjectENCORE2ENCORE2
Note
ID1108011081




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database