EIF2B4      CRISPR in K562      Control: NT-BGKcLV38-1,NT-BGKcLV38-2

General Information
RBPEIF2B4
Cell_LineK562
MethodCRISPR
Exp_NameEIF2B4-BGKcLV38-K562
ENCODE_series_ID
Batch_IDBGKcLV38
Pool IDPool-230127C
Local_Set_Nameset56
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1EIF2B4-BGKcLV38-41
Rep2EIF2B4-BGKcLV38-42
CN1NT-BGKcLV38-1
CN2NT-BGKcLV38-2
Rep1_qPCR37.0
Rep2_qPCR33.0
Rep1_WB58.1
Rep2_WB52.3
Antibody Cat#A302-983A
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1033




Experiment Information (Status: Submitting)
BGKcLV38-41BGKcLV38-41BGKcLV38-42BGKcLV38-42
idx1458145814591459
TRCN#_or_BGC#BGC#0000958BGC#0000958BGC#0000958BGC#0000958
shRNA_or_gRNA_sequenceACGAAGCAGGGCAATACACCACGAAGCAGGGCAATACACCACGAAGCAGGGCAATACACCACGAAGCAGGGCAATACACC
PAMgggggggggggg
NameEIF2B4_89EIF2B4_89EIF2B4_89EIF2B4_89
Sample_IDBGKcLV38-41BGKcLV38-41BGKcLV38-42BGKcLV38-42
transduction_Date10/18/2210/18/2210/18/2210/18/22
daysD6D6D6D6
RBP_nameEIF2B4EIF2B4EIF2B4EIF2B4
qPCR_result37.037.033.033.0
Ave_qPCR35.035.0
RT-qPCR_primer-Ftatctgcagcccaatgtcaatatctgcagcccaatgtcaa
RT-qPCR_primer-Rcgaccagctggaactttctccgaccagctggaactttctc
protein_conc3429342928732873
WB_result58.168.552.371.3926
Ave_WB55.269.9
WB_DONE_date11/4/227/19/23
MW58KD58KD
IP
antibody_Cat#A302-983AA302-982Alot # 1lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM0000
Rep2_TPM0000
ActionReadyReady
Library_start_date
repeat_library
Note
ID5646564856475649




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
EIF2B4Product_ID: A302-982A
Lot_ID: 1
Source: Bethyl Labs
Target Name: EIF2B4-human
EIF2B4-K562-CRISPR-A302-982A.png<br>Caption: Western blot following CRISPR against EIF2B4 in K562 whole cell lysate using EIF2B4 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF2B4. EIF2B4 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
EIF2B4Product_ID: A302-983A
Lot_ID: 1
Source: Bethyl Labs
Target Name: EIF2B4-human
EIF2B4-HEPG2-CRISPR-A302-983A.png<br>Caption: Western blot following CRISPR against EIF2B4 in HepG2 whole cell lysate using EIF2B4 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF2B4. EIF2B4 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
EIF2B4-K562-CRISPR-A302-983A.png<br>Caption: Western blot following CRISPR against EIF2B4 in K562 whole cell lysate using EIF2B4 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF2B4. EIF2B4 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV38-41BGKcLV38-42
Sample_IDBGKcLV38-41BGKcLV38-42
Sample Name
Sample NameEIF2B4-BGKcLV38-41EIF2B4-BGKcLV38-42
RBPEIF2B4EIF2B4
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2023-04-142023-04-14
ProjectENCORE2ENCORE2
Note
ID1104011041




Library-Prep Information
BGKcLV38-41BGKcLV38-42
Sample #7576
Sample NameEIF2B4-BGKcLV38-41EIF2B4-BGKcLV38-42
Sample_Name_Alias
Index Well PositionA11B11
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2023-01-192023-01-19
Lib_IDLib-230119Lib-230119
Tecan_Location
Tecan
Tecan_date
Size_bp303287
Peak_Molarity36.2068.70
libSampleQC_DNA_WellDNA_Library_set54-56/set2/A11.pngDNA_Library_set54-56/set2/B11.png
RIN9.99.9
libSample_RNA_WellRNA_Library_set54-56/set1/C10.pngRNA_Library_set54-56/set1/D10.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2023-01-272023-01-27
Sample_IDBGKcLV38-41BGKcLV38-42
RBPEIF2B4EIF2B4
Batch_IDBGKcLV38BGKcLV38
WB_result58.10052.300
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID34463447




Sequencing Information
BGKcLV38-41BGKcLV38-42
Sample_IDBGKcLV38-41BGKcLV38-42
Sample NameEIF2B4-BGKcLV38-41EIF2B4-BGKcLV38-42
Pool IDPool-230127CPool-230127C
LocalServer_folderset56set56
total_reads48,176,26647,369,524
total_aligned_reads44,683,35044,369,417
unique_aligned_reads41,681,01441,316,515
percent_uniqueAligned0.865180.87222
correlation_replicates0.9987510.998751
spikein_reads15,63211,594
percent_spikeins0.000320.00024
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID23172318




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
EIF2B4-BGKcLV38-41_S73_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2317NovaSeq6000100paired-ended1NT-BGKcLV38-1_S51_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R1_001.filtered.trimmed.paired.fastq.gzENCORE28322
EIF2B4-BGKcLV38-41_S73_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2317NovaSeq6000100paired-ended2NT-BGKcLV38-1_S51_L002_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE28360
EIF2B4-BGKcLV38-41_Aligned.sortedByCoord.out.bamENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2317GRCh38V40EIF2B4-BGKcLV38-41_S73_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF2B4-BGKcLV38-41_S73_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE216974
EIF2B4-BGKcLV38-41_Signal.Unique.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2317GRCh38V40EIF2B4-BGKcLV38-41/Aligned.sortedByCoord.out.bamENCORE217012
EIF2B4-BGKcLV38-41_Signal.Unique.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2317GRCh38V40EIF2B4-BGKcLV38-41/Aligned.sortedByCoord.out.bamENCORE217050
EIF2B4-BGKcLV38-41_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2317GRCh38V40EIF2B4-BGKcLV38-41/Aligned.sortedByCoord.out.bamENCORE217088
EIF2B4-BGKcLV38-41_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2317GRCh38V40EIF2B4-BGKcLV38-41/Aligned.sortedByCoord.out.bamENCORE217126
EIF2B4-BGKcLV38-41_quant.sfENCODE_DATA/set56/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2317GRCh38V40EIF2B4-BGKcLV38-41_S73_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF2B4-BGKcLV38-41_S73_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE217164
EIF2B4-BGKcLV38-42_S74_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2318NovaSeq6000100paired-ended1NT-BGKcLV38-1_S51_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R1_001.filtered.trimmed.paired.fastq.gzENCORE28323
EIF2B4-BGKcLV38-42_S74_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2318NovaSeq6000100paired-ended2NT-BGKcLV38-1_S51_L002_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE28361
EIF2B4-BGKcLV38-42_Aligned.sortedByCoord.out.bamENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2318GRCh38V40EIF2B4-BGKcLV38-42_S74_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF2B4-BGKcLV38-42_S74_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE216975
EIF2B4-BGKcLV38-42_Signal.Unique.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2318GRCh38V40EIF2B4-BGKcLV38-42/Aligned.sortedByCoord.out.bamENCORE217013
EIF2B4-BGKcLV38-42_Signal.Unique.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2318GRCh38V40EIF2B4-BGKcLV38-42/Aligned.sortedByCoord.out.bamENCORE217051
EIF2B4-BGKcLV38-42_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2318GRCh38V40EIF2B4-BGKcLV38-42/Aligned.sortedByCoord.out.bamENCORE217089
EIF2B4-BGKcLV38-42_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2318GRCh38V40EIF2B4-BGKcLV38-42/Aligned.sortedByCoord.out.bamENCORE217127
EIF2B4-BGKcLV38-42_quant.sfENCODE_DATA/set56/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2318GRCh38V40EIF2B4-BGKcLV38-42_S74_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF2B4-BGKcLV38-42_S74_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE217165