Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
EDC4
CRISPR
in K562
Batch: BGKcLV38
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV38-29
BGKcLV38-29
BGKcLV38-30
BGKcLV38-30
idx
1446
1446
1447
1447
TRCN#_or_BGC#
BGC#0000944
BGC#0000944
BGC#0000944
BGC#0000944
shRNA_or_gRNA_sequence
GATGTCGATGCTCGCGCAGG
GATGTCGATGCTCGCGCAGG
GATGTCGATGCTCGCGCAGG
GATGTCGATGCTCGCGCAGG
PAM
agg
agg
agg
agg
Name
EDC4_99
EDC4_99
EDC4_99
EDC4_99
Sample_ID
BGKcLV38-29
BGKcLV38-29
BGKcLV38-30
BGKcLV38-30
transduction_Date
10/18/22
10/18/22
10/18/22
10/18/22
days
D6
D6
D6
D6
RBP_name
EDC4
EDC4
EDC4
EDC4
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3521
3521
3479
3479
WB_result
no clear band on the position
no clear band on the position
Ave_WB
WB_DONE_date
11/4/22
7/20/23
MW
152KD
152KD
IP
antibody_Cat#
A300-746A
A300-745A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
0
0
Rep2_TPM
0
0
0
0
Action
Library_start_date
repeat_library
Note
ID
5632
5634
5633
5635
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV38-29
BGKcLV38-30
Sample_ID
BGKcLV38-29
BGKcLV38-30
Sample Name
Sample Name
RBP
EDC4
EDC4
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2023-01-03
2023-01-03
Project
ENCORE2
ENCORE2
Note
ID
11066
11067
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back