PABPN1      CRISPR in K562      Batch: BGKcLV37

Experiment Information (Status: NotSatisfied)
BGKcLV37-25BGKcLV37-26
idx13771378
TRCN#_or_BGC#BGC#0001041BGC#0001041
shRNA_or_gRNA_sequenceCCATCCCAAAGGGTAAGTAACCATCCCAAAGGGTAAGTAA
PAMAGGAGG
NamePABPN1-73PABPN1-73
Sample_IDBGKcLV37-25BGKcLV37-26
transduction_Date9/20/229/20/22
daysD6D6
RBP_namePABPN1PABPN1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc18411587
WB_result0.00.0
Ave_WB0.0
WB_DONE_date9/27/22, 10/12/22JESS, licor
MW33/50kd/
IPRabbit / I
antibody_Cat#14154Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID55375538




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV37-25BGKcLV37-26
Sample_IDBGKcLV37-25BGKcLV37-26
Sample Name
Sample Name
RBPPABPN1PABPN1
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-01-032023-01-03
ProjectENCORE2ENCORE2
Note
ID1112411125




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database