Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
DENR
CRISPR
in K562
Batch: BGKcLV37
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV37-17
BGKcLV37-18
idx
1369
1370
TRCN#_or_BGC#
BGC#0000907
BGC#0000907
shRNA_or_gRNA_sequence
TATAGTAACCTTTTGTGGTA
TATAGTAACCTTTTGTGGTA
PAM
cgg
cgg
Name
DENR_70
DENR_70
Sample_ID
BGKcLV37-17
BGKcLV37-18
transduction_Date
9/20/22
9/20/22
days
D6
D6
RBP_name
DENR
DENR
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
1957
1816
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
10/12/22
MW
22KD
IP
antibody_Cat#
A303-010A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5529
5530
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV37-17
BGKcLV37-18
Sample_ID
BGKcLV37-17
BGKcLV37-18
Sample Name
Sample Name
RBP
DENR
DENR
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2023-01-03
2023-01-03
Project
ENCORE2
ENCORE2
Note
ID
11118
11119
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back