Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
SRBD1
CRISPR
in K562
Batch: BGKcLV35
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV35-73
BGKcLV35-74
idx
1350
1351
TRCN#_or_BGC#
BGC#0000889
BGC#0000889
shRNA_or_gRNA_sequence
GGGGCATTCTTCTTCACCCG
GGGGCATTCTTCTTCACCCG
PAM
AGG
AGG
Name
SRBD1_90
SRBD1_90
Sample_ID
BGKcLV35-73
BGKcLV35-74
transduction_Date
4/28/22
4/28/22
days
D6
D6
RBP_name
SRBD1
SRBD1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2941
3124
WB_result
too many bands
Ave_WB
WB_DONE_date
5/11/22,5/16/22
JESS
MW
112kd
IP
antibody_Cat#
A305-121A
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5508
5509
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV35-73
BGKcLV35-74
Sample_ID
BGKcLV35-73
BGKcLV35-74
Sample Name
Sample Name
RBP
SRBD1
SRBD1
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2022-06-16
2022-06-16
Project
ENCORE2
ENCORE2
Note
ID
10933
10934
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back