AGO2      CRISPR in K562      Batch: BGKcLV15

Experiment Information (Status: NotSatisfied)
BGKcLV15-3BGKcLV15-4
idx531532
TRCN#_or_BGC#BGC#0000338BGC#0000338
shRNA_or_gRNA_sequenceCCGAGCGCCAGGACTCACCGCCGAGCGCCAGGACTCACCG
PAMgggggg
NameAGO2/-84AGO2/-84
Sample_IDBGKcLV15-3BGKcLV15-4
transduction_Date4/2/194/2/19
daysDay 6Day 6
RBP_nameAGO2AGO2
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc57825980
WB_result0.00.0
Ave_WB0.0
WB_DONE_date4/9/19,5/10/19WES
MW97KD
IPRabbitMonoclonal
antibody_Cat#MA5-14861
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM17.90
Rep2_TPM19.80
Action
Library_start_date
repeat_library
Note
ID46414642




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV15-3BGKcLV15-4
Sample_IDBGKcLV15-3BGKcLV15-4
Sample Name
Sample Name
RBPAGO2AGO2
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2020-09-122020-09-12
ProjectENCODE4ENCODE4
Note
ID53695370




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database