Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RPS14
CRISPR
in HepG2
Batch: BGHcLV50
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHcLV50-99
BGHcLV50-100
idx
0
0
TRCN#_or_BGC#
BGC#0001435
BGC#0001435
shRNA_or_gRNA_sequence
AGAGACGGGGGTCTTTCCGT
AGAGACGGGGGTCTTTCCGT
PAM
GGG
GGG
Name
RPS14_94U
RPS14_94U
Sample_ID
BGHcLV50-99
BGHcLV50-100
transduction_Date
7/29/25
7/29/25
days
D6
D6
RBP_name
RPS14
RPS14
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3048
3277
WB_result
0.0
0.0
Ave_WB
WB_DONE_date
8/28/25,8/26/25
MW
16KD
IP
antibody_Cat#
A304-031A
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
10103
10104
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHcLV50-99
BGHcLV50-100
Sample_ID
BGHcLV50-99
BGHcLV50-100
Sample Name
Sample Name
RBP
RPS14
RPS14
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-09-30
2025-09-30
Project
ENCORE2
ENCORE2
Note
ID
14552
14553
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back