Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RPS14
CRISPR
in HepG2
Batch: BGHcLV50
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequencing
)
BGHcLV50-97
BGHcLV50-98
idx
0
0
TRCN#_or_BGC#
BGC#0000811
BGC#0000811
shRNA_or_gRNA_sequence
GCCCGATCTTCATACCCGAG
GCCCGATCTTCATACCCGAG
PAM
CGG
CGG
Name
RPS14_70
RPS14_70
Sample_ID
BGHcLV50-97
BGHcLV50-98
transduction_Date
7/29/25
7/29/25
days
D6
D6
RBP_name
RPS14
RPS14
qPCR_result
50.1
64.6
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
1972
1966
WB_result
44.8
57.2912
Ave_WB
WB_DONE_date
9/2/25,8/28/25,8/26/
MW
16KD
IP
antibody_Cat#
A304-031A
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
10101
10102
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHcLV50-97
BGHcLV50-98
Sample_ID
BGHcLV50-97
BGHcLV50-98
Sample Name
Sample Name
RPS14-BGHcLV50-97
RPS14-BGHcLV50-98
RBP
RPS14
RPS14
Cell_Line
HepG2
HepG2
Exp UID
Status
Sequencing
Sequencing
Status_date
2025-10-10
2025-10-10
Project
ENCORE2
ENCORE2
Note
ID
14468
14469
Library-Prep
Sequencing
Library-Prep Information
BGHcLV50-97
BGHcLV50-98
Sample #
21
22
Sample Name
RPS14-BGHcLV50-97
RPS14-BGHcLV50-98
Sample_Name_Alias
Index Well Position
E12
F12
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-10-01
2025-10-01
Lib_ID
Lib-251001
Lib-251001
Tecan_Location
Tecan
Tecan_date
Size_bp
286
279
Peak_Molarity
81.90
76.90
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-10-03
2025-10-03
Sample_ID
BGHcLV50-97
BGHcLV50-98
RBP
RPS14
RPS14
Batch_ID
BGHcLV50
BGHcLV50
WB_result
44.800
57.291
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4836
4837
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back