Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RBM42
CRISPR
in HepG2
Batch: BGHcLV50
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequencing
)
BGHcLV50-91
BGHcLV50-91
BGHcLV50-92
BGHcLV50-92
idx
0
0
0
0
TRCN#_or_BGC#
BGC#0001364
BGC#0001364
BGC#0001364
BGC#0001364
shRNA_or_gRNA_sequence
TGTTGGTCGCGATAATTGGG
TGTTGGTCGCGATAATTGGG
TGTTGGTCGCGATAATTGGG
TGTTGGTCGCGATAATTGGG
PAM
CGG
CGG
CGG
CGG
Name
RBM42_93
RBM42_93
RBM42_93
RBM42_93
Sample_ID
BGHcLV50-91
BGHcLV50-91
BGHcLV50-92
BGHcLV50-92
transduction_Date
7/29/25
7/29/25
7/29/25
7/29/25
days
D6
D6
D6
D6
RBP_name
RBM42
RBM42
RBM42
RBM42
qPCR_result
63.3
64.0
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3574
3574
3102
3102
WB_result
64.1
51.1
51.6
56.9
Ave_WB
WB_DONE_date
8/21/25
9/16/25
MW
50KD
50KD
IP
antibody_Cat#
A305-139A
A305-138A
LOT #1
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
0
0
Rep2_TPM
0
0
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
10093
10095
10094
10096
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHcLV50-91
BGHcLV50-91
BGHcLV50-92
BGHcLV50-92
Sample_ID
BGHcLV50-91
BGHcLV50-91
BGHcLV50-92
BGHcLV50-92
Sample Name
Sample Name
RBM42-BGHcLV50-91
RBM42-BGHcLV50-92
RBP
RBM42
RBM42
RBM42
RBM42
Cell_Line
HepG2
HepG2
HepG2
HepG2
Exp UID
Status
Sequencing
NotSatisfied
Sequencing
NotSatisfied
Status_date
2025-10-10
2025-09-30
2025-10-10
2025-09-30
Project
ENCORE2
ENCORE2
ENCORE2
ENCORE2
Note
ID
14466
14546
14467
14547
Library-Prep
Sequencing
Library-Prep Information
BGHcLV50-91
BGHcLV50-92
Sample #
19
20
Sample Name
RBM42-BGHcLV50-91
RBM42-BGHcLV50-92
Sample_Name_Alias
Index Well Position
C12
D12
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-10-01
2025-10-01
Lib_ID
Lib-251001
Lib-251001
Tecan_Location
Tecan
Tecan_date
Size_bp
292
287
Peak_Molarity
71.10
65.00
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-10-03
2025-10-03
Sample_ID
BGHcLV50-91
BGHcLV50-92
RBP
RBM42
RBM42
Batch_ID
BGHcLV50
BGHcLV50
WB_result
64.100
51.600
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4834
4835
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back