RBM12      CRISPR in HepG2      Batch: BGHcLV50

Experiment Information (Status: NotSatisfied)
BGHcLV50-83BGHcLV50-84
idx00
TRCN#_or_BGC#BGC#0001252BGC#0001252
shRNA_or_gRNA_sequenceCAATGCGGGACTGCCCGGTGCAATGCGGGACTGCCCGGTG
PAMTGGTGG
NameRBM12_92RBM12_92
Sample_IDBGHcLV50-83BGHcLV50-84
transduction_Date7/29/257/29/25
daysD6D6
RBP_nameRBM12RBM12
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc30833103
WB_result0.00.0
Ave_WB
WB_DONE_date8/21/25
MW97KD
IP
antibody_Cat#A301-198ALOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID1008510086




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHcLV50-83BGHcLV50-84
Sample_IDBGHcLV50-83BGHcLV50-84
Sample Name
Sample Name
RBPRBM12RBM12
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-09-302025-09-30
ProjectENCORE2ENCORE2
Note
ID1453814539




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database