FGFR1OP      CRISPR in HepG2      Batch: BGHcLV50

Experiment Information (Status: NotSatisfied)
BGHcLV50-61BGHcLV50-62
idx00
TRCN#_or_BGC#BGC#0001336BGC#0001336
shRNA_or_gRNA_sequenceGTCTTGGAGAAGCAAGATGGGTCTTGGAGAAGCAAGATGG
PAMCGGCGG
NameFGFR1OP_54FGFR1OP_54
Sample_IDBGHcLV50-61BGHcLV50-62
transduction_Date7/29/257/29/25
daysD6D6
RBP_nameFGFR1OPFGFR1OP
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc19671711
WB_result4.613.7
Ave_WB
WB_DONE_date8/19/25,8/26/25
MW43kd
IP
antibody_Cat#A301-861Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID1006110062




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHcLV50-61BGHcLV50-62
Sample_IDBGHcLV50-61BGHcLV50-62
Sample Name
Sample Name
RBPFGFR1OPFGFR1OP
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-09-302025-09-30
ProjectENCORE2ENCORE2
Note
ID1451814519




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database