ZNF335      CRISPR in HepG2      Batch: BGHcLV50

Experiment Information (Status: Sequencing)
BGHcLV50-113BGHcLV50-114
idx00
TRCN#_or_BGC#BGC#0001444BGC#0001444
shRNA_or_gRNA_sequenceGTGGGGCAAAGCTCGGACCGGTGGGGCAAAGCTCGGACCG
PAMCGGCGG
NameZNF335_90ZNF335_90
Sample_IDBGHcLV50-113BGHcLV50-114
transduction_Date7/29/257/29/25
daysD6D6
RBP_nameZNF335ZNF335
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc30592894
WB_result63.259.7803
Ave_WB
WB_DONE_date8/28/25redo after get NEW A
MW145KD
IPRabbit / IPolyclonal
antibody_Cat#PA5-67158lot# UC2731469A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID1011710118




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHcLV50-113BGHcLV50-114
Sample_IDBGHcLV50-113BGHcLV50-114
Sample Name
Sample NameZNF335-BGHcLV50-113ZNF335-BGHcLV50-114
RBPZNF335ZNF335
Cell_LineHepG2HepG2
Exp UID
StatusSequencingSequencing
Status_date2025-10-102025-10-10
ProjectENCORE2ENCORE2
Note
ID1447014471




Library-Prep Information
BGHcLV50-113BGHcLV50-114
Sample #2324
Sample NameZNF335-BGHcLV50-113ZNF335-BGHcLV50-114
Sample_Name_Alias
Index Well PositionG12H12
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2025-10-012025-10-01
Lib_IDLib-251001Lib-251001
Tecan_Location
Tecan
Tecan_date
Size_bp281282
Peak_Molarity69.5054.60
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2025-10-032025-10-03
Sample_IDBGHcLV50-113BGHcLV50-114
RBPZNF335ZNF335
Batch_IDBGHcLV50BGHcLV50
WB_result63.20059.780
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID48384839




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database