ZNF335      CRISPR in HepG2      Batch: BGHcLV50

Experiment Information (Status: NotSatisfied)
BGHcLV50-111BGHcLV50-112
idx00
TRCN#_or_BGC#BGC#0001445BGC#0001445
shRNA_or_gRNA_sequenceAGGCCGATGACTCTGGCGTGAGGCCGATGACTCTGGCGTG
PAMGGGGGG
NameZNF335_86ZNF335_86
Sample_IDBGHcLV50-111BGHcLV50-112
transduction_Date7/29/257/29/25
daysD6D6
RBP_nameZNF335ZNF335
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc23152488
WB_result57.442.5915
Ave_WB
WB_DONE_date9/3/25,8/28/25redo after get NEW A
MW145KD
IPRabbit / IPolyclonal
antibody_Cat#PA5-67158lot# UC2731469A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID1011510116




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHcLV50-111BGHcLV50-112
Sample_IDBGHcLV50-111BGHcLV50-112
Sample Name
Sample Name
RBPZNF335ZNF335
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-09-302025-09-30
ProjectENCORE2ENCORE2
Note
ID1456414565




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database