Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
SPATS2L
CRISPR
in HepG2
Batch: BGHcLV50
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHcLV50-105
BGHcLV50-106
idx
0
0
TRCN#_or_BGC#
BGC#0001439
BGC#0001439
shRNA_or_gRNA_sequence
TTGGGCCGGAAGCCGTTGTG
TTGGGCCGGAAGCCGTTGTG
PAM
CGG
CGG
Name
SPATS2L_92
SPATS2L_92
Sample_ID
BGHcLV50-105
BGHcLV50-106
transduction_Date
7/29/25
7/29/25
days
D6
D6
RBP_name
SPATS2L
SPATS2L
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2302
3985
WB_result
0.0
0.0
Ave_WB
WB_DONE_date
8/26/25
MW
62kd
IP
antibody_Cat#
A305-118A
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
10109
10110
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHcLV50-105
BGHcLV50-106
Sample_ID
BGHcLV50-105
BGHcLV50-106
Sample Name
Sample Name
RBP
SPATS2L
SPATS2L
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-09-30
2025-09-30
Project
ENCORE2
ENCORE2
Note
ID
14558
14559
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back