RPS28      CRISPR in HepG2      Batch: BGHcLV49

Experiment Information (Status: Sequencing)
BGHcLV49-95BGHcLV49-96
idx00
TRCN#_or_BGC#BGC#0000823BGC#0000823
shRNA_or_gRNA_sequenceTTCGGGCCCCCACCTCACCCTTCGGGCCCCCACCTCACCC
PAMTGGTGG
NameRPS28_55RPS28_55
Sample_IDBGHcLV49-95BGHcLV49-96
transduction_Date6/6/256/6/25
daysD6D6
RBP_nameRPS28RPS28
qPCR_result50.348.0
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc30043597
WB_result52.254.0
Ave_WB
WB_DONE_date7/1/25
MW7.8kd
IP
antibody_Cat#A305-095ALOT #1
Antibody DCC IDENCAB557DQG
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID99799980




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
RPS28Product_ID: A305-095A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RPS28-human
RPS28-hepg2-CRISPR-A305-095A-LICOR.png<br>Caption: Western blot following CRISPR against RPS28 in HepG2 whole cell lysate using RPS28 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RPS28. RPS28 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
RPS28-K562-CRISPR-A305-095A.png<br>Caption: Western blot following CRISPR against RPS28 in K562 whole cell lysate using RPS28 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RPS28. RPS28 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGHcLV49-95BGHcLV49-96
Sample_IDBGHcLV49-95BGHcLV49-96
Sample Name
Sample NameRPS28-BGHcLV49-95RPS28-BGHcLV49-96
RBPRPS28RPS28
Cell_LineHepG2HepG2
Exp UID
StatusSequencingSequencing
Status_date2025-09-292025-09-29
ProjectENCORE2ENCORE2
Note
ID1436214363




Library-Prep Information
BGHcLV49-95BGHcLV49-96
Sample #5960
Sample NameRPS28-BGHcLV49-95RPS28-BGHcLV49-96
Sample_Name_Alias
Index Well PositionE08F08
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2025-08-202025-08-20
Lib_IDLib-250820Lib-250820
Tecan_Location
Tecan
Tecan_date
Size_bp264260
Peak_Molarity71.2075.00
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2025-09-102025-09-10
Sample_IDBGHcLV49-95BGHcLV49-96
RBPRPS28RPS28
Batch_IDBGHcLV49BGHcLV49
WB_result52.20054.000
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID48044805




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database