Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
EZH2
CRISPR
in HepG2
Batch: BGHcLV49
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequencing
)
BGHcLV49-61
BGHcLV49-62
idx
0
0
TRCN#_or_BGC#
BGC#0001006
BGC#0001006
shRNA_or_gRNA_sequence
TTATGATGGGAAAGTACACG
TTATGATGGGAAAGTACACG
PAM
GGG
GGG
Name
EZH2_81
EZH2_81
Sample_ID
BGHcLV49-61
BGHcLV49-62
transduction_Date
6/6/25
6/6/25
days
D6
D6
RBP_name
EZH2
EZH2
qPCR_result
0.0
25.0
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
4622
1931
WB_result
64.1
58.1
Ave_WB
WB_DONE_date
7/3/25
MW
85kd
IP
antibody_Cat#
5246S
lot # 10
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
9941
9942
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
EZH2
Product_ID:
5246S
Lot_ID: 10
Source: Cell Signaling Technology
Target Name: EZH2-human
Experiment Status
BGHcLV49-61
BGHcLV49-62
Sample_ID
BGHcLV49-61
BGHcLV49-62
Sample Name
Sample Name
EZH2-BGHcLV49-61
EZH2-BGHcLV49-62
RBP
EZH2
EZH2
Cell_Line
HepG2
HepG2
Exp UID
Status
Sequencing
Sequencing
Status_date
2025-09-29
2025-09-29
Project
ENCORE2
ENCORE2
Note
ID
14352
14353
Library-Prep
Sequencing
Library-Prep Information
BGHcLV49-61
BGHcLV49-62
Sample #
49
50
Sample Name
EZH2-BGHcLV49-61
EZH2-BGHcLV49-62
Sample_Name_Alias
Index Well Position
C07
D07
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-08-20
2025-08-20
Lib_ID
Lib-250820
Lib-250820
Tecan_Location
Tecan
Tecan_date
Size_bp
274
271
Peak_Molarity
129.00
80.70
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-09-10
2025-09-10
Sample_ID
BGHcLV49-61
BGHcLV49-62
RBP
EZH2
EZH2
Batch_ID
BGHcLV49
BGHcLV49
WB_result
64.100
58.100
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4794
4795
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back