EIF2B5      CRISPR in HepG2      Batch: BGHcLV49

Experiment Information (Status: Sequencing)
BGHcLV49-53BGHcLV49-54
idx00
TRCN#_or_BGC#BGC#0000960BGC#0000960
shRNA_or_gRNA_sequenceGAAGCGGCGATCGAAGCTATGAAGCGGCGATCGAAGCTAT
PAMCGGCGG
NameEIF2B5_98EIF2B5_98
Sample_IDBGHcLV49-53BGHcLV49-54
transduction_Date6/6/256/6/25
daysD6D6
RBP_nameEIF2B5EIF2B5
qPCR_result65.461.6
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc35984458
WB_result59.776.6
Ave_WB
WB_DONE_date7/15/25
MW80KD
IP
antibody_Cat#A302-556Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID99339934




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
EIF2B5Product_ID: A302-556A
Lot_ID: 1
Source: Bethyl Labs
Target Name: EIF2B5-human
EIF2B5-hepg2-CRISPR-A302-556A-LICOR.png<br>Caption: Western blot following CRISPR against EIF2B5 in HepG2 whole cell lysate using EIF2B5 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF2B5. EIF2B5 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
EIF2B5-K562-CRISPR-A302-556A.png<br>Caption: Western blot following CRISPR against EIF2B5 in K562 whole cell lysate using EIF2B5 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF2B5. EIF2B5 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGHcLV49-53BGHcLV49-54
Sample_IDBGHcLV49-53BGHcLV49-54
Sample Name
Sample NameEIF2B5-BGHcLV49-53EIF2B5-BGHcLV49-54
RBPEIF2B5EIF2B5
Cell_LineHepG2HepG2
Exp UID
StatusSequencingSequencing
Status_date2025-09-292025-09-29
ProjectENCORE2ENCORE2
Note
ID1434814349




Library-Prep Information
BGHcLV49-53BGHcLV49-54
Sample #4546
Sample NameEIF2B5-BGHcLV49-53EIF2B5-BGHcLV49-54
Sample_Name_Alias
Index Well PositionG06H06
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2025-08-202025-08-20
Lib_IDLib-250820Lib-250820
Tecan_Location
Tecan
Tecan_date
Size_bp265257
Peak_Molarity72.2044.80
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2025-09-102025-09-10
Sample_IDBGHcLV49-53BGHcLV49-54
RBPEIF2B5EIF2B5
Batch_IDBGHcLV49BGHcLV49
WB_result59.70076.600
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID47904791




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database